• 검색 결과가 없습니다.

Expression Analysis of OsCPK11 by ND0001 oscpk11 Mutants of Oryza sativa L. under Salt, Cold and Drought Stress Conditions

N/A
N/A
Protected

Academic year: 2021

Share "Expression Analysis of OsCPK11 by ND0001 oscpk11 Mutants of Oryza sativa L. under Salt, Cold and Drought Stress Conditions"

Copied!
11
0
0

로드 중.... (전체 텍스트 보기)

전체 글

(1)

Expression Analysis of OsCPK11 by ND0001 oscpk11 Mutants of Oryza sativa L. under Salt, Cold and Drought Stress Conditions

Hyeon-Mi Kim

1

and Sung-Ha Kim

2*

1

Kangwon Science High School, 2242, Chiak-ro, Wonju-si, Gangwon-do 26323, Korea

2

Department of Biology Education, Korea National Univ. of Education, 250 Taesungtabyeon-ro, Gangnae-myeon, Heungdeok-gu, Cheongju-si, Chungbuk 28173, Korea

Received February 4, 2021 /Revised February 23, 2021 /Accepted February 24, 2021

Calcium-dependent protein kinases (CDPKs) are known to be involved in regulating plant responses to abiotic stresses such as salinity, cold temperature and dehydration,. Although CDPKs constitute a large multigene family consisting of 31 genes in rice, only a few rice CDPKs’ functions have been identified. Therefore, in order to elucidate the functions of OsCPK11 in rice, this study was intended to focus on the expression pattern analysis of OsCPK11 in wild type and ND0001 oscpk11 mutant plants under these abiotic stresses. For the salt, cold and drought stress treatment, seedlings were ex- posed to 200 mM NaCl, 4℃ and 20% PEG 6,000, respectively. RT-PCR and quantitative real-time PCR were performed to determine the expression patterns of OsCPK11 in wild type and ND0001 mutant plants. RT-PCR results showed that OsCPK11 transcripts in the wild type and heterozygous mutant were detected, but not in the homozygous mutant. Real-time PCR results showed that relative ex- pression of OsCPK11 of wild type plants was increased and reached to the highest level at 24 hr, at 6 hr and at 24 hr under salt, cold and drought stress conditions, respectively. Relative expression of OsCPK11 of ND0001 homozygous plant was significantly reduced compared to that of wild type. These results suggested that oscpk11 homozygous mutant knocks out OsCPK11 and OsCPK11 might be in- volved in salt, cold and drought stress signaling by regulating its gene expression.

Key words : Abiotic stress, gene expression, ND0001, OsCPK11, rice

*Corresponding author

*Tel : +82-43-230-3738, Fax : +82-43-232-7176

*E-mail : [email protected]

This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Introduction

Plants have developed a network of signal transduction pathways to control their metabolism and to adapt to their environments [3]. Among these pathways, Ca

2+

has long been recognized as a conserved second messenger and a principal mediator in plant stress responses [6]. Calcium co- ordinates a variety of physiological responses upon percep- tion of both external and endogenous factors [11].

There are two kinds of stresses: abiotic stimuli include light, low and high temperature, touch, hyperosmotic stress, and oxidative stress, while biotic stimuli include plant hor- mones such as abscissic acid and gibberellin (GA), fungal elicitors, and nodulation (NOD) factors [29]. The targets of Ca

2+

signal transduction pathways can be divided into two

categories: primary sensors and downstream substrates [28].

Ca

2+

sensors are a set of proteins that sense the change in cytosolic free Ca

2+

[18] and have been studied in plants.

There is a large and differentiated group that includes cal- cium-dependent protein kinases (CDPKs), calmodulins (CaMs), CaM-like proteins, and calcineurin B-like proteins [26].

Plants contain a number of kinase families that neither are found in animals nor yeast. CDPKs are calcium-regu- lated and are different from other kinase families in a struc- tural arrangement in which a calmodulin-like regulatory do- main is located at the C-terminal end of the enzyme [15].

CDPKs have many different substrates and it implicates the diversity of their functions. It has been identified that the potential protein substrates of CDPKs are involved in carbon and nitrogen metabolism, phospholipid synthesis, defense responses, ion and water transport, cytoskeleton or- ganization, transcription and hormone responses [12]. Nicoti- ana tabacum CDPK, NtCPK4 transcripts were accumulated 60 min after treatment with 100 μM GA and decreased in 2 hr, and it was suggested that NtCPK4 might be involved in the GA signal transduction [39].

Both elevation in transcription level and an activity in-

crease of CDPKs have been identified in responses to differ-

(2)

ent stresses [18]. NtCDPK1 transcripts were increased within 1 hr after NaCl treatment and the level was continued until 24 hr [37]. ZmCPK11 transcripts were increased in the wounded leaf after 3 hr, and showed the highest level of transcripts at 6 hr after wounding [32]. The tomato CDPK, LeCDPK1 transcripts were increased in the leaves treated with pathogen elicitors, H

2

O

2

and mechanical wounding, and these results suggested that this kinase might be a part of physiological plant defense mechanism against biotic or abiotic stresses [9]. ZmCPK10 has been identified that might be involved in pathogen defense response. ZmCPK10 tran- scripts were rapidly increased at 5 min after elicitation and it reached to the maximum level at 30 min after treatment [24]. Nine CDPK genes in Fragaria x ananassa were identi- fied based on RNA-seq data [20]. These identified strawberry FaCDPK genes were classified into four main groups, based on the phylogenetic analysis and structural features. FaCDPK genes were differentially expressed during fruit develop- ment and ripening, as well as in response to abiotic stress and hormone treatment [20].

Thirty one CDPK genes have been identified in Oryza sat- iva by a genome-wide analysis [7, 25], and several rice CDPK genes have been characterized. RNA gel blot analyses re- vealed that the majority of rice CDPK genes exhibited a tis- sue-specific expression [5]. Furthermore, the expression of rice CDPK genes has been shown to be tissue-specific and they were classified into seven groups based on their ex- pression patterns [34]. Lee et al. [20] showed that OsCPK11 gene was expressed in mature leaves, young leaves and flowers of rice.

Some rice CDPKs have been reported to be involved in tolerance to abiotic stresses. OsCPK12-overexpressing (OsCPK12- OX) plants increased their tolerance to salt stress [4]. The level of hydrogen peroxide (H

2

O

2

) accumulation in the leaves was less in OsCPK12-OX plants than that in WT plants [4]. The expression level of genes encoding reactive oxygen species (ROS) scavenging enzymes (OsAPx2 and OsAPx8) in OsCPK12-OX plants was higher than that in WT plants [4]. Meanwhile, the sensitivity to the higher salinity of a Tos17 insertion mutant, oscpk12 became higher than that of WT plants [4]. The level of H

2

O

2

accumulation became greater in oscpk12 than that in WT plants, suggesting that OsCPK12 promotes a tolerance to the salt stress by reducing ROS accumulation [4].

OsCPK4 expression was induced by high salinity and drought [7]. The tolerance to the salt and drought stresses

was significantly increased in OsCPK4 overexpressing plants, however its knockdown rice plants were severely im- paired in growth and development [7]. Also, OsCPK4 over- expressor plants exhibit stronger water-holding capability and reduced levels of membrane lipid peroxidation under drought or salt stress conditions compared with control plants [7]. Moreover, a significant number of genes involved in lipid metabolism and protection against oxidative stress were up-regulated by OsCPK4 in the roots of OsCPK4 over- expressing plants [7]. These results suggested that OsCPK4 is a positive regulator of the salt and drought stress re- sponses by protecting cellular membranes from stress-in- duced oxidative damage [7].

OsCPK9 expression was induced by drought and salt stress treatments [35]. The survival rate of OsCPK9-OX plants became higher than that of WT, while OsCPK9-RNAi lines showed very low survival rate under drought condition [35].

It was found that OsCPK9-OX plants have more proline and soluble sugars, while OsCPK9-RNAi plants have less proline and soluble sugars compared to control plants under drought condition [35].

Additionally, OsCPK9-OX lines showed less proportion of the completely open stomata under drought condition, while OsCPK9-RNAi lines showed more proportion of them com- pared to control plants [35]. These results suggested that OsCPK9 is involved in a positive regulation of drought stress signaling pathway by enhancing stomatal closure [35].

Tos17 element (for transposon of Oryza sativa) is appro- priate for application in the systematic analysis of gene func- tion, considering the frequency of transposition observed in their original or heterologous hosts [13]. The size of Tos17 element is 4114 base pairs and its copy number in the rice genome is known to be very low [13] and Nipponbare which has been chosen as a standard cultivar for the International Rice Genome Sequencing Project [30]. Tos17 element is acti- vated in cultured cells [14]. Moreover, when plants have been regenerated from the cultured cells, Tos17 retrotrans- position is immediately inactivated [23].

Previous studies have shown that Tos17 insertion repre- sents a loss-of-function alleles [31]. Their studies indicated that the transposon-tagged gene was expected to be a loss- of-function allele, because Tos17 was inserted into the fourth exon of OSH15, upstream of the homeodomain region [31].

Northern blot analysis showed that OSH15 transcripts were

detected in both WT and heterozygous plants, but not in

the homozygous plants [31]. Moreover, the expression level

(3)

Fig. 1. OsCPK11 gene structure showing Tos17 insertion site for the oscpk11 mutant line, ND0001 [19]. Exons and introns are indicated by black/grey boxes and lines, respectively. Arrows indicate the positions of genotyping primers.

of OSH15 transcripts was about twice as strong in WT plants than that in heterozygous plants [31]. Phenotypes of both WT plants and heterozygous plants have no abnormality un- der normal condition, while homozygous plants showed a dwarf phenotype [31]. Their results suggested that Tos17 in- sertion was genetically associated with its dwarf phenotype [31].

Based on the 'Rice Tos17 insertion mutant database' pro- vided by National Institute of Agrobiological Sciences in Japan, Tos17 inserted mutant lines for the OsCPK11 gene were presented [19]. They are ND0001, ND2038, NE4004, NF6012, NG6533, NG9519, and others. ND0001 was used for this study and the position of Tos17 insertion in OsCPK11 gene was represented based on the information of the 'Rice Tos17 insertion mutant database' as shown in Fig. 1 [19].

In order to elucidate the function of OsCPK11 in rice, this study was intended to focus on the expression patterns of OsCPK11 in wild type and ND0001 mutant plants under abiotic stresses.

Materials and Methods

Materials

Chemicals were purchased from the following sources:

Sportak EC was from SG HanKookSamGong (KOREA).

Arisweeper was from Syngenta Korea, Inc. (KOREA). Cefo- taxime sodium was from Duchefa Biochemie (Haarlem, Netherlands). Biopure

TM

agarose, Solg

TM

2X Taq PCR Smart mix, Solg

TM

2X Real-Time PCR Smart mix (including Eva Green

TM

in the mixture) and 100bp DNA marker were from Solgent (KOREA). Deoxyribonuclease I (DNase I), 10X DNase I reaction buffer, 25 mM EDTA solution, 50 μM oligo(dT)

20

, 10 mM dNTP mix, 10X RT buffer, 25 mM MgCl

2

, 0.1 M DTT, RNaseOUT

TM

(40 U/μl), RNase H, SuperScript® III RT (200 U/μl) and TRIzol reagent were from Invitrogen Inc. (Carls- bad, CA, USA). Primers were synthesized from GenoTech Corp. (KOREA). All other chemicals were commercial prod- ucts of analytical grade.

Plant materials

The National Institute of Agrobiological Science in Japan provided rice (Oryza sativa L. cv. Nipponbare) seeds of mu- tant line ND0001 in which retrotransposon Tos17 had been inserted into the OsCPK11 gene. Nipponbare wild type was also used in this study. Rice seeds were sterilized with 0.05%

Sportak EC and 0.025% Arisweeper for 48 hr in the dark.

Seeds were then washed with distilled water (DW) and ger- minated in 0.2% Cefotaxime. Seeds were incubated under constant temperature of 28℃±1℃ with a 16-hr-light/8-hr- dark cycle for 5 days. The 5-day-old seedlings were trans- ferred to a plastic pot containing Yoshida’s nutrient solution [38] for 9 days. Yoshida’s nutrient solution was changed to its half concentration on the 14

th

day for acclimation. In order to evaluate the effects of abiotic stresses on rice seedlings, young leaves were harvested. For the genotyping of the mu- tant lines, 15-day-old leaves were collected before the stress treatment. Samples were immediately frozen in the liquid nitrogen and stored at -70℃ until used [20].

Stress treatment

Rice plants were grown in a growth chamber under con-

stant temperature of 28℃±1℃ with a 16-hr-light/8-hr-dark

cycle. Seeds were sterilized and germinated on the filter pa-

per soaked in 0.2% Cefotaxime for 5 days. The 5-day-old

seedlings were transferred to a plastic pot containing Yoshi-

da’s nutrient solution for up to 9 days. To acclimate the rice

seedlings, Yoshida’s solution was changed to its half concen-

tration on the 14

th

day. For the salt stress treatment, 15-day-

old seedlings were exposed to 200 mM NaCl up to 24 hr

[34]. For the drought stress treatment, 15-day-old seedlings

were exposed to 20% PEG 6,000 up to 24 hr [34]. And for

the cold stress treatment, 15-day-old seedlings were exposed

to 4℃ up to 24 hr [34]. Each young leaves were harvested

at 0, 3, 6, 12 and 24 hr after initiation of treatment for each

treatment. Samples were immediately frozen in the liquid

nitrogen and stored at -70℃ until RNA extraction [20].

(4)

Table 1. Primers used for the genotyping PCR

Primer Sequence

ND0001/NG6533 ND0001/NG6533_UTR

Tos17_tail3

5‘ - TTACAAGTACCCACCGGCTC - 3’

5’ - GCATGCATGATCCAAATCAG - 3’

5’ - GAGAGCATCATCGGTTACATCTTCTC - 3’

Table 2. Primers used for the RT-PCR

Primer Sequence

Actin gene primers F

R

5’ - CATCTTGGCATCTCTCAGCAC - 3’

5’ - AACTTTGTCCACGCTAATGAA - 3’

OsCPK11 gene primers F

R

5’ - GTTGCTCCTGACAAGCCTCT - 3’

5’ - TCCGGTACTATGCTGACCCA - 3’

Genotyping of oscpk11 mutants by PCR

The ND0001 mutant lines of oscpk11 mutants were de- termined for their genotypes. For the genotyping, genomic DNA was extracted using the WizPrep

TM

Plant DNA Mini Kit (Wizbiosolutions, KOREA). About 50 mg of young leaves of each individual were manually ground into fine powder with liquid nitrogen and was treated as described in Manu- facturer’s instructions. The purified DNA was either stored at -20℃ or used immediately for PCR. Primers for the PCR were synthesized by GenoTech Corp. (Daejeon, KOREA) and are listed in Table 1. PCR was performed in a final 20 μl volume including 10 μl of Solg

TM

2X Taq PCR Smart mix, 6.5 μl of DEPC-DW, 0.5 μl of DNA sample and each 1 μl of gene-specific primers (10 pmoles/μl), using the thermal cycles as follows: 94℃ for 4 min for 1 cycle, 94℃ for 45 sec, 55℃ for 45 sec, 72℃ for 90 sec for 30 cycles and 72℃

for 5 min for 1 cycle. PCR products were separated on 1.5%

agarose gels and photographed under UV light.

Reverse transcription - polymerase chain reaction (RT-PCR)

Total RNA was extracted from rice leaves using TRIzol reagent following the manufacturer's instructions (Invitro- gen Inc., USA). Young leaves were manually ground into fine powder with liquid nitrogen and the homogenized sam- ple was proceeded to extract total RNA as describe in [17].

cDNA synthesis was performed using deoxyribonuclease I and SuperScript® Ⅲ First-Strand Synthesis System (Invitro- gen Inc., USA) as described in Manufacturer’s instructions [17]. The primers for RT-PCR were designed with Primer 3 software and primer sequences were checked by using Basic Local Alignment Search Tool of National Center for Biotechnology Information (NCBI) in order to gene specific

amplification by the primers. The primers for the RT-PCR were synthesized by GenoTech Corp. (Daejeon, KOREA) and are listed in Table 2. RT-PCR was performed in a final 20 μl volume, including 10 μl of Solg

TM

2X Taq PCR Smart mix, 6.5 μl of DEPC-DW, 1 μl of forward primer (10 pmoles/

μl), 1 μl of reverse primer (10 pmoles/μl), and 1.5 μl of cDNA RT product, using the thermal cycles as follows: 94℃ for 5 min for 1 cycle, 94℃ for 1 min, 57℃ for 1 min, 72℃ for 1 min for 38 cycles and 72℃ for 5 min for 1 cycle. Amplifica- tion of target genes were performed with PCR MultiGene

TM

II Personal Thermal Cycler (Labnet, USA). Actin gene was used as an endogenous control to normalize variance in the quality of RNA and the amount of cDNA used. PCR prod- ucts were separated on 1.5% agarose gels, and photographed under UV light.

Quantitative real–time PCR

In order to confirm the expression patterns of OsCPK11 gene under abiotic stress conditions, real–time PCR analysis was performed. Total RNA extraction and reverse tran- scription were performed as described above for the RT- PCR. The primers for real-time PCR were synthesized by GenoTech Corp. (Daejeon, KOREA) and are listed in Table 3. Real–time PCR was performed in a final 20 μl volume, containing 7 μl of DEPC-DW, 10 μl of Solg

TM

2X Real-Time PCR Smart mix (including EvaGreen

TM

in the mixture), 1 μl of forward primer (10 pmoles/μl), 1 μl of reverse primer (10 pmoles/μl) and 1 μl of cDNA template, using the thermal cycles as follows: 95℃ for 15 min for 1 cycle, 95℃ for 20 sec, 57℃ for 30 sec, and 72℃ for 30 sec for 45 cycles. EF-α1 gene was used as an endogenous control to normalize var- iance in the quality of RNA and the amount of cDNA used.

Amplification of the target gene was monitored in every cy-

(5)

Table 3. Primers used for the quantitative real-time PCR

Primer Sequence

EF- α 1 gene primers F

R

5’ - GACTGGTACAAGGGCCCCACCTTG - 3’

5’ - CCAGTCTCAACACGACCCACAGG - 3’

OsCPK11 gene primers F

R

5’ - TGATAAAGATGGCAGCGGT - 3’

5’ - TCCGTCCATCATTGTCCTGA - 3’

A

B

C

D

Fig. 2. Phenotypic features of the wild type and ND0001 mutant plants by stress conditions. They were grown for about 2 weeks at 28℃±1℃ in a growth chamber. Compared to no stress (A) condition, they were exposed to 200 mM NaCl, 4℃ and 20%

PEG 6,000 respectively for the salt stress (B), cold stress (C) and drought stress (D) conditions. Photographs were taken 24 hr after each stress treatments.

cle using Evagreen fluorescence. Relative quantity of the ex- pression level of the target gene was determined by using the 2

-ΔΔCT

method [23] with CFX 96 Touch Multi-Color Real- Time PCR Detection System (Bio-Rad, USA). Quantitative real–time PCR experiment was replicated three times.

Relative amounts were calculated and normalized with re- spect to the expression of OsCPK11 with each treatment at 0 hr in wild type plants.

Results

Expression of OsCPK11 in wild type and ND0001 mutant plants

It seemed to be clear that Tos17 system could significantly contribute to the functional genomics of rice [13]. In this study, in order to elucidate the biological function of OsCPK11 in rice, the expression of OsCPK11 in wild type and ND0001 mutant plants were investigated under abiotic stresses. In ND0001 mutant plant, Tos17 is reversely inserted into the 6

th

exon of OsCPK11 as shown in Fig. 1 [19].

The phenotypes of oscpk11 mutants have been studied be- fore [20]. There was no significant difference in the height between wild type and oscpk11 mutants lines (ND0001 and NF6012), but there was statistically meaningful differences (p<0.01) in the caryopsis number per panicle and the car- yopsis weight [20].

In this study, the phenotypes of ND0001 mutants were

not investigated quantitatively, but difference of the features

between wild type and ND0001 mutant plants could be seen

under abiotic stress conditions (Fig. 2). Color of the leaves

of wild type plants looked darker compared to that of the

leaves of ND0001 mutant plants under either no stress or

any stress condition. Besides, leaf area of wild type plants

looked larger compared to that of ND0001 mutant plants

under either no stress or any stress condition. Leaves of

ND0001 mutant plants looked more withered compared to

those of wild type plants under salt stress (Fig. 2B) and

drought stress (Fig. 2D) conditions. In particular, this mor-

phological change was clearly observed under cold stress

condition (Fig. 2C). Any significant difference was not found

(6)

Fig. 3. Genotyping result of the wild type and ND0001 mutant plants. PCR was performed using primers for the geno- typing. Wild type plants showed a single band around 1.1 kb. oscpk11 heterozygous plants showed double bands around 1.1 kb and 600 bp, while oscpk11 homozygous plants showed a single band around 600 bp. M indicates DNA molecular weight marker. Lane 1; wild type plants, lane 2; oscpk11 heterozygous plants, lane 3; oscpk11 ho- mozygous plants.

(1) (2) (3) A

B

C

D

Fig. 4. Expression of OsCPK11 in wild type and ND0001 mutant plants under no stress (A), salt stress (B), cold stress (C) and drought stress (D) conditions. The expression of OsCPK11 under each condition was determined by RT-PCR using 15-day-old seedlings of wild type (1), ND0001 heterozygous mutant (2) and homozygous mutant (3) plants. RT-PCR analysis showed that OsCPK11 transcripts in the wild type under each condition (A~D) were detected for 24hr, but not in the homozygous mutant. It also showed that OsCPK11 transcripts in the heterozygous mutant under no stress (A) condition did not change much for 24hr, but salt stress (B), cold stress (C) and drought stress (D) conditions in the heterozygous mutant seemed to reduce some of OsCPK11 transcripts as time went on.

between heterozygous mutant and homozygous mutant plants, although their quantitative data were not presented.

Genotyping was performed to identify ND0001 hetero- zygous and homozygous mutant plants. Wild type plants showed a single band around 1.1 kb and oscpk11 hetero- zygous plants showed double bands around 1.1 kb and 600 bp, while oscpk11 homozygous plants showed a single band around 600 bp as expected (Fig. 3).

RT-PCR was performed to aim to elucidate the biological function of OsCPK11 under salt, cold and drought stress conditions. Results showed that the expression of OsCPK11 in wild type and ND0001 mutant plants in Fig. 4. OsCPK11 transcripts in the wild type and heterozygous mutant were detected, but not in the homozygous mutant under no stress condition (Fig. 4A). OsCPK11 transcripts in the wild type and heterozygous mutant were detected, but not in the ho- mozygous mutant under salt stress (Fig. 4B), cold stress (Fig.

4C) and drought stress (Fig. 4D) conditions. It implied that oscpk11 homozygous mutant represents a knockout mutant.

It was also shown that the level of OsCPK11 transcripts in

(7)

A B

C D

Fig. 5. Relative expression of OsCPK11 in wild type and ND0001 mutant plants under no stress condition. Relative expressions of OsCPK11 under no stress (A), salt stress (B), cold stress (C) and drought stress (D) conditions were measured by qRT-PCR using 15-day-old seedlings of wild type and ND0001 (homozygous and heterozygous) plants. qRT-PCR results showed that relative expression of OsCPK11 of wild type, oscpk11 homozygous and heterozygous mutants under no stress (A) condition do not change much up to 24 hr. Its relative expression in wild type plants under salt stress (B) condition is increased within 3 hr and reached to the highest level at 24 hr. It also showed that its relative expression of OsCPK11 in wild type plants under cold stress (C) condition is increased within 3 hr and reached to the highest level at 6 hr, while its relative expression under drought stress (D) condition is increased within 3 hr and reached to the highest level at 24 hr. For each condition, the value of wild type plant at 0 hr was set as 1, and the others were normalized to this one. Each value is the mean ±SE of three independent experiments.

the heterozygous mutant under no stress (A) condition did not change much for 24hr, but salt stress (B), cold stress (C) and drought stress (D) conditions seemed to reduce some of OsCPK11 transcripts as time went on.

Relative expression of OsCPK11 in wild type and ND0001 mutant plants

Relative expression of OsCPK11 under salt, cold and

drought stress conditions was investigated in wild type and ND0001 mutant plants by a quantitative real–time PCR.

The 2

-ΔΔCT

method is a convenient way to analyze the relative change in gene expression based on quantitative real-time PCR experiments [21].

Relative expression of OsCPK11 of ND0001, both homo-

zygous and heterozygous mutant plants, was significantly

reduced compared to that of wild type (Fig. 5). It seemed

(8)

to be clear that oscpk11 homozygous mutant is a knockout mutant. It was shown unexpectedly that relative expression of OsCPK11 in oscpk11 heterozygous mutant showed rela- tively similar to that of oscpk11 homozygous mutant.

Relative expression of OsCPK11 of wild type, oscpk11 ho- mozygous and heterozygous mutants under no stress con- dition do not change much up to 24 hr (Fig. 5A). Relative expression of OsCPK11 of wild type plants under salt stress condition is increased and reached to the highest level (approximately 70-fold) at 24 hr (Fig. 5B). Relative expre- ssion of OsCPK11 transcript of wild type plants is increased and reached to the highest level (approximately 6-fold) at 6 hr after cold stress condition (Fig. 5C), while it reached to the highest level (approximately 40-fold) at 24 hr after drought stress condition (Fig. 5D).

Therefore, based on the results in Fig. 5, OsCPK11 tran- scription in the wild type plants seemed to be up-regulated by salt, cold and drought stress treatments, implying its pos- sible function related with responses to these stresses. Jang [16] previously reported that relative expression of OsCPK11 in wild type plants was increased up to 48 hr by either salt or drought stress treatments, but not by cold stress treatment.

Discussion

In order to elucidate the biological function of the OsCPK11 gene in rice, the expression of OsCPK11 of wild type and ND0001 mutant plants treated with salt, cold and drought stresses were investigated. In this study, 15-day-old leaves were used and RT-PCR and quantitative real-time PCR were performed to determine expression of OsCPK11 in wild type and ND0001 mutant plants.

RT-PCR results showed that OsCPK11 transcripts in the wild type and heterozygous mutant were detected, but not in the homozygous mutant. Similarly, Asano et al. [4] re- ported that OsCPK12 expression in the oscpk12 homozygous mutant was abolished by the insertion of Tos17. Also, no transcript was observed in the cpk10 homozygous plants [40]. The expression of OsCPK11 in wild type and oscpk11 heterozygous mutant plants under no stress, salt, cold and drought stress conditions was not significantly changed up to 24 hr.

There are some other CDPKs which have shown to be associated with abiotic stress conditions. The expression of OsCPK21 transcripts was increased by the salt, with the highest level at 5 hr after treatment [2]. OsCPK6 and

OsCPK25 were up-regulated by drought and heat stresses, respectively, and OsCPK17 was down-regulated by cold, drought and salt stresses [34]. Also, the expression of AtCDPK1 and AtCDPK2 was rapidly induced by drought and high salt stress [33], AtCPK3 kinase activity was strongly detected by salt stress treatment [22].

Quantitative real-time PCR results showed that relative expression of OsCPK11 was increased by salt, cold and drought stresses in wild type plants. Interestingly, relative expression of OsCPK11 in wild type plants is increased and reached to the highest level at 24 hr (approximately 70-fold), at 6 hr (approximately 6-fold) and at 24 hr (approximately 40-fold) under salt, cold and drought stress conditions, respectively. Similarly, Saijo et al. [27] found that tran- scription of OsCDPK7 gene increased in response to cold and salt stresses, and overexpressing OsCDPK7 gene resulted in an enhanced tolerance of transgenic plants to drought, salt, and cold stresses.

Based on semi-quantitative RT-PCR analysis, Chehab et al. [8] found that transcription of McCPK1 gene of the com- mon ice plant Mesembryanthemum crystallinum was increased after 1 to 2.5 hr following high salinity and dehydration stress, respectively. AtCPK10 was induced to be expressed by drought treatment within 30 min and decreased to the initial level after 3 hr [40]. AtCPK6 transcripts appeared within 10 min after the initiation of drought or salt treatment and reached to the highest level at 1 hr [36]. This suggested that AtCPK6 was induced by drought or salt stresses [36].

Furthermore, relative expression of OsCPK11 of ND0001 homozygous plant was significantly reduced compared to that of wild type, implying that oscpk11 mutant is a knockout mutant. It was expected that relative expression of OsCPK11 of oscpk11 heterozygous mutant could be higher than that of homozygous mutant and about the half of that of wild type. However, our results showed that relative expression of OsCPK11 of oscpk11 heterozygous mutant is similar to that of oscpk11 homozygous mutant. These results might be caused by some technical limitations during quantitative re- al-time PCR.

Functions of CDPKs in salt and drought stress signaling

have been investigated in many studies, however those in

cold stress signaling remain mostly elusive [6]. OsCDPK13

gene expression was increased in response to cold, but de-

creased under salt and drought stresses [1]. Similarly, the

relative expression of OsCPK11 transcript of wild type plants

is increased by cold stress treatment in this study. Therefore,

(9)

rice CDPKs may be involved in a cold tolerance, but their molecular functions remain to be determined.

Collectively, results presented here suggested that oscpk11 homozygous mutant knocks out OsCPK11 and OsCPK11 might be involved in salt, cold and drought stress signaling by regulating its gene expression. However, in order to elu- cidate the specific mechanism of CDPK-mediated stress re- sponse, the downstream components of OsCPK11 remain to be identified.

According to the recent reports, there are phenotypic dif- ferences between wild type and OsCPKs-OX plants or loss- of-function mutant plants under abiotic stresses. OsCPK12- OX plants showed an increased tolerance to salt stress in contrast to the oscpk12 mutants and OsCPK12-RNAi plants showed a decreased tolerance to salt stress [4]. Dry weights of shoots and roots of the OsCPK12-OX plants were heavier than those of WT plants, while those of oscpk12 or OsCPK12- RNAi plants were less than those of WT plants under salt stress condition [4]. The survival rate of OsCPK9-OX plants was higher than that of WT, while OsCPK9-RNAi plants showed very low survival rate [35]. The chlorophyll content was higher in OsCPK9-OX plants, but lower in OsCPK9- RNAi plants compared to that of WT under drought stress condition [35].

These results indicated that CDPKs in rice could affect their phenotypes and play as a positive/negative regulator under abiotic stresses. In this study, difference of phenotypic features between wild type and ND0001 mutant plants un- der abiotic stress conditions was observed, but they were not measured quantitatively. Therefore, further studies will be needed to determine quantitatively how their phenotypes are changed by Tos17 insertion. It will be also determined whether expression of wild type and ND0001 mutant plants confers tolerance to the salt, cold, drought and other abiotic and biotic stresses.

The Conflict of Interest Statement

The authors declare that they have no conflicts of interest with the contents of this article.

References

1. Abbasi, F., Onodera, H., Toki, S., Tanaka, H. and Komatsu, S. 2004. OsCDPK13, a calcium-dependent protein kinase gene from rice, is induced by cold and gibberellin in rice leaf sheath. Plant Mol. Biol. 55, 541-552.

2. Asano, T., Hakata, M., Nakamura, H., Aoki, N., Komatsu, S., Ichikawa, H., Hirochika, H. and Ohsugi, R. 2011.

Functional characterisation of OsCPK21, a calcium-depend- ent protein kinase that confers salt tolerance in rice. Plant Mol. Biol. 75, 179-191.

3. Asano, T., Hayashi, N., Kikuchi, S. and Ohsugi, R. 2012.

CDPK-mediated abiotic stress signaling. Plant Signal Behav.

7, 817-821.

4. Asano, T., Hayashi, N., Kobayashi, M., Aoki, N., Miyao, A., Mitsuhara, I., Ichikawa, H., Komatsu, S., Hirochika, H., Kikuchi, S. and Ohsugi, R. 2012. A rice calcium-dependent protein kinase OsCPK12 oppositely modulates salt-stress tolerance and blast disease resistance. Plant J. 69, 26-36.

5. Asano, T., Tanaka, N., Yang, G., Hayashi, N. and Komatsu, S. 2005. Genome-wide identification of the rice calcium-de- pendent protein kinase and its closely related kinase gene families: comprehensive analysis of the CDPKs gene family in rice. Plant Cell Physiol. 46, 356-366.

6. Boudsocq, M. and Sheen, J. 2013. CDPKs in immune and stress signaling. Trends Plant Sci. 18, 30-40.

7. Campo, S., Baldrich, P., Messeguer, J., Lalanne, E., Coca, M. and San Segundo, B. 2014. Overexpression of a cal- cium-dependent protein kinase confers salt and drought tol- erance in rice by preventing membrane lipid peroxidation.

Plant Physiol. 165, 688-704.

8. Chehab, E. W., Patharkar, O. R., Hegeman, A. D., Taybi, T. and Cushman, J. C. 2004. Autophosphorylation and sub- cellular localization dynamics of a salt- and water deficit-in- duced calcium-dependent protein kinase from ice plant.

Plant Physiol. 135, 1430-1446.

9. Chico, J. M., Raices, M., Tellez-Inon, M. T. and Ulloa, R.

M. 2002. A calcium-dependent protein kinase is systemically induced upon wounding in tomato plants. Plant Physiol. 128, 256-270.

10. Crizel, R. L., Perin, E. C., Vighi, I. L., Woloski, R., Seixas, A., Pinto, L. da S., Rombaldi, C. V. and Galli, V. 2020.

Genome-wide identification, and characterization of the CDPK gene family reveal their involvement in abiotic stress response in Fragaria x ananassa. Sci. Rep. 10, 11040.

11. Delormel, T. Y. and Boudsocq, M. 2019. Properties and func- tions of calcium-dependent protein kinases and their rela- tives in Arabidopsis thaliana. New Phytologist 224, 585-604.

12. Harper, J. F. and Harmon, A. 2005. Plants, symbiosis and parasites: a calcium signalling connection. Nat. Rev. Mol. Cell Biol. 6, 555-566.

13. Hirochika, H. 2001. Contribution of the Tos17 retrotrans- poson to rice functional genomics. Curr. Opin. Plant Biol.

4, 118-122.

14. Hirochika, H., Sugimoto, K., Otsuki, Y., Tsugawa, H. and Kanda, M. 1996. Retrotransposons of rice involved in muta- tions induced by tissue culture. Proc. Natl. Acad. Sci. USA.

93, 7783-7788.

15. Hrabak, E. M., Chan, C. W., Gribskov, M., Harper, J. F., Choi, J. H., Halford, N., Kudla, J., Luan, S., Nimmo, H. G., Sussman, M. R., Thomas, M., Walker-Simmons, K., Zhu, J.

K. and Harmon, A. C. 2003. The Arabidopsis CDPK-SnRK

(10)

superfamily of protein kinases. Plant Physiol. 132, 666-680.

16. Jang, B. R. 2013. Expression pattern of OsCPK11 from rice under different environmental stress conditions. Thesis for the master's degree, Korea National University of Education, Chungbuk, Korea.

17. Kim, H. M. 2015. Expression analysis of OsCPK11 under abiotic stress conditions in ND0001 oscpk11 mutants of Oryza sativa L. Thesis for the master's degree, Korea National University of Education, Chungbuk, Korea.

18. Klimecka, M. and Muszynska, G. 2007. Structure and func- tions of plant calcium-dependent protein kinases. Acta Bio- chim. Pol. 54, 219-233.

19. Lee, J. E. 2008. Functional analysis of OsCPK11, a calcium- dependent protein kinase gene from rice. Thesis for master's degree, Korea National University of Education, Chungbuk, Korea.

20. Lee, S. H., Lee, J. E., Day, P., Gilroy, S. and Kim, S. H. 2017.

A functional analysis of OsCPK11, a calcium-dependent protein kinase (CDPK) gene in rice. J. Life Sci. 27, 1233-1244.

21. Livak, K. J. and Schmittgen, T. D. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2

-ΔΔCT

method. Methods 25, 402-408.

22. Mehlmer, N., Wurzinger, B., Stae, S., Hofmann-Rodrigues, D., Csaszar, E., Pfister, B., Bayer, R. and Teige, M. 2010.

The Ca

2+

-dependent protein kinase CPK3 is required for MAPK-independent salt-stress acclimation in Arabidopsis.

Plant J. 63, 484-498.

23. Miyao, A., Iwasaki, Y., Kitano, H., Itoh, J. I., Maekawa, M., Murata, K., Yatou, O., Nagato, Y. and Hirochika, H. 2007.

A large-scale collection of phenotypic data describing an in- sertional mutant population to facilitate functional analysis of rice genes. Plant Mol. Biol. 63, 625-635.

24. Murillo, I., Jaeck, E., Cordero, M. J. and San Segundo, B.

2001. Transcriptional activation of a maize calcium-depend- ent protein kinase gene in response to fungal elicitors and infection. Plant Mol. Biol. 45, 145-158.

25. Ray, S., Agarwal, P., Arora, R., Kapoor, S. and Tyagi, A.

K. 2007. Expression analysis of calcium-dependent protein kinase gene family during reproductive development and abiotic stress conditions in rice (Oryza sativa L. ssp. indica).

Mol. Gen. Genet. 278, 493-505.

26. Reddy, V. S. and Reddy, A. S. 2004. Proteomics of calcium- signaling components in plants. Phytochemistry 65, 1745-1776.

27. Saijo, Y., Kinoshita, N., Ishiyama, K., Hata, S., Kyozuka, J., Hayakawa, T., Nakamura, T., Shimamoto, K., Yamaya, T.

and Izui, K. 2001. A Ca

2+

-dependent protein kinase that en- dows rice plants with cold- and salt-stress tolerance func- tions in vascular bundles. Plant Cell Physiol. 42, 1228-1233.

28. Sanders, D., Brownlee, C. and Harper, J. F. 1999. Communi- cating with calcium. Plant Cell 11, 691-706.

29. Sanders, D., Pelloux, J., Brownlee, C. and Harper, J. F. 2002.

Calcium at the crossroads of signaling. Plant Cell 14 Suppl, S401-417.

30. Sasaki, T. and Burr, B. 2000. International Rice Genome Sequencing Project: the effort to completely sequence the rice genome. Curr. Opin. Plant Biol. 3, 138-141.

31. Sato, Y., Sentoku, N., Miura, Y., Hirochika, H., Kitano, H.

and Matsuoka, M. 1999. Loss-of-function mutations in the rice homeobox gene OSH15 affect the architecture of intern- odes resulting in dwarf plants. EMBO J. 18, 992-1002.

32. Szczegielniak, J., Klimecka, M., Liwosz, A., Ciesielski, A., Kaczanowski, S., Dobrowolska, G., Harmon, A. C. and Mus- zynska, G. 2005. A wound-responsive and phospholipid- regulated maize calcium -dependent protein kinase. Plant Physiol. 139, 1970-1983.

33. Urao, T., Katagiri, T., Mizoguchi, T., Yamaguchi-Shinozaki, K., Hayashida, N. and Shinozaki, K. 1994. Two genes that encode Ca

2+

-dependent protein kinases are induced by drought and high-salt stresses in Arabidopsis thaliana. Mol.

Gen. Genet. 244, 331-340.

34. Wan, B., Lin, Y. and Mou, T. 2007. Expression of rice Ca

2+

-de- pendent protein kinases (CDPKs) genes under different en- vironmental stresses. FEBS Lett. 581, 1179-1189.

35. Wei, S., Hu, W., Deng, X., Zhang, Y., Liu, X., Zhao, X., Luo, Q., Jin, Z., Li, Y., Zhou, S., Sun, T., Wang, L., Yang, G. and He, G. 2014. A rice calcium-dependent protein kinase OsCPK9 positively regulates drought stress tolerance and spikelet fertility. BMC Plant Biol. 14, 133.

36. Xu, J., Tian, Y. S., Peng, R. H., Xiong, A. S., Zhu, B., Jin, X. F., Gao, F., Fu, X. Y., Hou, X. L. and Yao, Q. H. 2010.

AtCPK6, a functionally redundant and positive regulator in- volved in salt/drought stress tolerance in Arabidopsis.

Planta 231, 1251-1260.

37. Yoon, G. M., Cho, H. S., Ha, H. J., Liu, J. R. and Lee, H.

S. 1999. Characterization of NtCDPK1, a calcium-dependent protein kinase gene in Nicotiana tabacum, and the activity of its encoded protein. Plant Mol. Biol. 39, 991-1001.

38. Yoshida, S., Forno, D. A. and Cock, J. H. 1971. Laboratory manual for physiological studies of rice, International Rice Research Institute, Los Banos, Laguna, pp. 61-62.

39. Zhang, M., Liang, S. and Lu, Y. T. 2005. Cloning and func- tional characterization of NtCPK4, a new tobacco calcium- dependent protein kinase. Biochim. Biophys. Acta, 1729, 174- 185.

40. Zou, J. J., Wei, F. J., Wang, C., Wu, J. J., Ratnasekera, D.,

Liu, W. X. and Wu, W. H. 2010. Arabidopsis calcium-de-

pendent protein kinase CPK10 functions in abscisic acid-

and Ca

2+

-mediated stomatal regulation in response to dro-

ught stress. Plant Physiol. 154, 1232-1243.

(11)

초록:염분, 저온 및 가뭄 스트레스 조건에서 벼 ND0001 oscpk11 돌연변이체의 OsCPK11 발현 분석

김현미

1

․김성하

2

*

(

1

강원과학고,

2

한국교원대 생물교육과)

칼슘-의존성 단백질 카이네이즈(CDPK)는 식물의 Ca

2+

매개 신호 전달에 필수적인 역할을 한다. CDPK는 염분,

저온, 가뭄 등과 같은 비생물적 스트레스에 대한 식물의 반응을 조절하는 데 관여하는 것으로 알려져 있다. 벼의 CDPK는 31개의 유전자로 구성된 거대 다유전자군으로 되어 있지만, 단지 일부 벼의 CDPK 기능만이 확인되었다.

따라서, 벼에서 OsCPK11의 기능을 알아보기 위해, 이 연구는 염분, 저온 및 가뭄과 같은 비생물적 스트레스 조건

에서 벼의 야생형과 ND0001 oscpk11 돌연변이체의 OsCPK11 발현 분석에 초점을 맞추었다. 염분, 저온, 가뭄 스트

레스 처치를 위해 유식물을 각각 200 mM NaCl, 4℃, 20% PEG 6,000에 노출시켰다. 야생형과 ND0001 돌연변이

체에서 OsCPK11의 발현을 확인하기 위해 RT-PCR과 quantitative real-time PCR을 수행하였다. RT-PCR 결과에

의하면, 야생형과 이형접합성 돌연변이체에서는 OsCPK11 전사체가 검출되었지만, 동형접합성 돌연변이체에서는

검출되지 않았다. Quantitative real-time PCR 결과에 의하면 야생형에서 염분, 저온, 가뭄 스트레스에 의해

OsCPK11의 상대적인 발현이 증가하였으며, 각각 24시간, 6시간, 24시간 후 최대 수준에 도달하였다. ND0001 동형

접합성 돌연변이체의 OsCPK11의 상대적 발현은 야생형에 비해 현저히 감소하였다. 이러한 결과는 oscpk11 동형접

합성 돌연변이체에서는 OsCPK11발현을 완전히 저해하며, OsCPK11유전자 발현 조절이 염분, 저온 및 가뭄 스트

레스 신호 전달 과정에 관여할 수 있음을 의미한다.

수치

Fig.  1.  OsCPK11  gene  structure  showing  Tos17  insertion  site  for  the  oscpk11  mutant  line,  ND0001  [19]
Table  1.  Primers  used  for  the  genotyping  PCR Primer Sequence ND0001/NG6533 ND0001/NG6533_UTR Tos17_tail3 5‘  -  TTACAAGTACCCACCGGCTC  -  3’ 5’  -  GCATGCATGATCCAAATCAG  -  3’ 5’  -  GAGAGCATCATCGGTTACATCTTCTC  -  3’
Fig.  2.  Phenotypic  features  of  the  wild  type  and  ND0001  mutant  plants  by  stress  conditions
Fig.  4.  Expression  of  OsCPK11  in  wild  type  and  ND0001  mutant  plants  under  no  stress  (A),  salt  stress  (B),  cold  stress  (C)  and  drought  stress  (D)  conditions
+2

참조

관련 문서

b) oxidation state of contaminants (esp. the most oxidized C) - general rules for the determination of oxidation state (Table 7.1).. benzene..); reduced --&gt; degraded

Micro- and nano-sized pores were formed on the surface of the alloy using PEO and anodization methods, and the pore shape change according to the Zr

Advisor: prof. We will look into a criterion of definition and type of condition the base of a existing theory. Expression called condition is defined

In this way, it is possible to shorten the time of accident restoration and maintenance by minimizing the expression error of the high-strength facial

Eroticism make-up will be the best solution to appeal to the buyer and expression of make-up that is based on pure emotions and sexual tangle is developed by the needs of

The aim of this work was to prepare tenoxicam-ethanolamine salt with improved physicochemical properties, to compare the flux of tenoxicam and

Effect of LRP6 on survivin expression in hypoxic cardiomyocytes (A) Expression of survivin in Ad-LRP6 and silencing LRP6 infected cardiomyocytes as determined by western

 Effects of salt on hydrate-containing phase equilibria were experimentally determined for H-Lw equilibria and predicted for three-phase ( H-I-V C2H6 , H-L W -V C2H6 , H-L W