Development of PCR-dot blot hybridization for the diagnosis of alcelaphine herpesvirus 1

99

      

    !


^* ^

1
   ,
    

2  

( !: 2003" 10# 7$)

Development of PCR-dot blot hybridization for the diagnosis of alcelaphine herpesvirus 1

Okjin Kim¹* and Hong Li²

1Department of Laboratory Animal Sciences and Center for Animal Resource Development, College of Medicine, Seoul National University, Seoul 110-799, Korea

2USDA - ARS, Animal Disease Research Unit, Pullman, WA 99164, USA (Accepted
October 7, 2003)

Abstract : The aim of the present study was to develop a sensitive and specific assay for the diagnosis of alcelaphine herpesvirus 1 (AlHV-1) which is a cause agent of malignant catarrhal fever in ruminants.

A1HV-1 is a gamma herpesvirus, which is frequent latent, and it is often difficult to detect its antigens or specific nucleic acids because of its low genomic copies in the infected tissues. In this study, polymerase chain reaction (PCR)-dot blot hybridization (DBH) assay for detecting AlHV-1 DNA was developed and evaluated for its sensitivity and specificity as comparison with PCR and DBH alone. The developed PCR- DBH was more sensitive than PCR or DBH alone and also very specific. The results showed that the sensitivity of PCR-DBH were higher and stronger than those of PCR and DBH alone. This PCR-DBH assay can be applied efficiently to confirm the presence of AlHV-1 virus on clinical samples and to differentiate specifically between AlHV-1 infection and other viral infections.

Key words : PCR, dot blot hybridization, PCR-dot blot hybridization



Alcelaphine herpesvirus 1 (AlHV-1) gamma herpesvirus  , ovine herpesvirus 2 (OvHV-2)  malignant catarrhal fever (MCF) ,   

 ! " #$%&' !( ) *+, %-.

/ 01)2 [15]. 345 6 ! 78, 9 : 345/ ;<=>?, @A B CD " 3

45 BE FG,H I=J KLH MNOP Q2 [13]. R4?, 345 ;<J R ;<S PT

UVWX YZJ [\ ]^ _`=a bc de 9:E _` =J f g7 9:LH J h4

Si jkE Si l2. m), nFo BE Cp=

>? @A B/ Cp=J KL qD 345f ^

 rs tH ) CD. uvS cjS w M l2. xy, ;z{|} ~ 345 €E Cp=J KL 9:aLH ‚ƒO lH,  4) aLfJ u a E „…,H !†=h R ‡ˆ/ Cp‰ M lJ AŠ‹ŒŽt (polymerase chain reaction, PCR) O l2. AlHV-1 6 

‘| lymph node‚’ 10⁵“ UV” 1“ UV

DNA mJ 345 B X•tE I‰ M l–

2J 'f‚’ AlHV-1 —˜ ™ copy M n Fo ;VE š M l2 [2, 14]. m), AlHV-1

*Corresponding author: Okjin Kim

Department of Laboratory Animal Sciences, College of Medicine, Seoul National University, Seoul 110-799, Korea [Tel: 82-2-740-8077, Fax: 82-2-763-5206, E-mail: [email protected]]

herpesvirus ›œ6 E q~=a bc 7•  '/ ) KLH ž6vS —˜ Ÿ KL `'O

 l2. 4) q, AlHV-1 9:LHJ ž6 vS Ÿ PCR  < D¡O lJ ¢£2. R4

?, PCR m) [  ) X• (false positive) t

 nFo PCR inhibitorf ) ¤• t (false negative)f cjS w M l¤ O l2 [1, 3, 12]. 2e ;z{|}, 9:LH in situ hybridization

 dot blot hybridization (DBH) PCR 2Z¥, !†

£ [J [ cj/ ¦‰ M l, u£ a 

 hybridizationE §) u, tE ¨E M la bc, R . Ÿ $©v/ Sg M lJ ªH

š«¬ l2 [12]. R4?, 345 €CpE ) DBHJ R n­ ^®=, uvS Ÿ ¯, €

!†£E >*i °a bc PCR ±=h ž6vS

™ ªH O l2 [6, 8, 18]. AlHV-1 gamma herpesvirus z² ›œ6 E q~=h 6  nFo

 —˜ ™ ³v ‡ˆ=a bc R 9: —˜

P«´ ªH š«¬l2. Yµ , AlHV-1 ) ›

œ6 “ 9:, 345 a# '/ ¶ J,

2 ž6) 9: KLf “~ `'OPi l2.

· 'J gamma herpesvirus ›œ6 E q~=

h, nFo —˜ ™ copy M ‡ˆ=J 345

AlHV-1 ¸Œ¹ 345 ;V/ I‰ M lJ PCR-DBH/ “~=z MNO–2.

  

     

AlHV-1 open reading frame 50 a  u,

 outer primer C500-1 C500-2 (Table 1)/ D¡=

h PCRE MN=º2 [11]. Primer nucleotide position  alcelaphine herpesvirus 1 DNA polymerase a

 a0=º2 [7, 11]. PCRE ) tn•| 2 µg template DNA, 10 mM Tris-HCl, 50 mM KCl, 2 mM MgCl2, 400 µM dATP, dCTP, dGTP, dTTP (Roche, USA), 20 pmol primer C500-1 " C500-2, 5 U Taq DNA

polymerase (Roche, USA)S 100 µl t¡¹ ƒƒ

VOv» =º2. Thermal cycler 9700 (Perkin-Elmer, USA)E ¡=h 94^oC 5;^ preheating £ ¼, 94^oC 300, 55^oC 1;, 72^oC 1; cycleE 40½ ¢]) ¼ 72^oC 7; x¾ extension :¿/ >À A1HV-1 u €

E !†=º2.

     

AlHV-1 open reading frame 50 a  u,

 inner primer C500-3 C500-4 (Table 1)/ D¡=

h, PCRE MN= !† 273 bp A1HV-1 DNA

non-radioactive |g digoxigenin (DIG)E Ái=h DBH D¡w probe/ ±=º2. !† AlHV-1 DNAJ Wizard DNA purification system^ (Promega, USA)E ¡=h purification=º,  ¼ purification

 €!†|E 10;^ à ¼ 3 Ĥ (Å denaturation]Æ, Hexanucleotide mixture dNTP labeling mixture/ Ç ¼, Klenow enzymeE S=

37^oC 20]^ t=h, DIG % Ái probe/

¨–2.  ¼, 0.2 M EDTA (pH 8.0)/ S=, 65^oC

 10;^ SÈ=h ‹ŒÉ•E j> ¼, ]Ê D

¡w bËi -20^oC Ì=º2.

     

± DIG-labeled probe/ D¡=h AlHV-1E Cp

‰ M lJ PCR-DBH protocolE “~=º2. “~

PCR-DBH £ 2¤ ÍÎ2. Nylon membrane (Roche, USA)E ]Ê D¡ SÏ) Ða ze ¼, C500-1 C500-2 primer ÑE D¡=h ¨ CD ˆÒ PCR !†| (amplicon) DNA 2 µl/ membrane ,¡

=, ÓÔ ÕZa # tip ÖH ÓÔ ,¡ ‚

×E Ø4 */ Á]) ¼, ÓÔ */ 2e ¾

 ,P aÙ=º2. ÓÔ DNAS ,¡ membraneE -È denaturation buffer 5;^ ,¡) ¼, -È

neutralizing buffer 5;^ ,¡=º2. 1% SDSS q

 2X SSC buffer 2; UÚ ¼, UV cross-linker (Stratagene, USA)/ D¡=h, membrane DNA/

Table 1. PCR primers: sequences and positions

Primers Sequences (5’-3’) Nucleotide position^a)

C500-1 TACGGGAGCCCTGACATTTCATCTCTTTTG 73917-74014

C500-2 ATAACTGGTTGATGTGGCAGATGCATCTAT 74292-74321

C500-3 TCTGGCCCGTGCTGCAGCAAGACTCTCAG 73986-74014

C500-4 TATAGTAGAATCCCGTCTGAGTGGTAGCTG 74230-74259

aAll nucleotide positions in the DNA polymerase sequence of AlHV-1 (C-500) [7].

cross-link ]Æ, hybridization bufferS fP lJ sealing bag membraneE Û Ü, DIG-labeled DNA/ ,¡=

 sealing=h, 50^oC 3]^ t]Ý2. ¼, membraneE 1% SDSS q 2X SSC buffer -È

 5; " 1X SSC 65^oC 15;^ UÚ ¼, - È 1X washing buffer 1;, -È 1X blocking buffer 30; £E >Þ2. ¼, membraneE anti- digoxigenin-AP (Roche, USA) t]Æ, alkaline phosphatase ag nitroblue tetrazolium (NBT) 5- bromocresyl-3-indolyl-phosphate (BCIP) (Roche, USA)/

ÇP ~ß]à ¼ ÓÔ ,¡) ‚ áâßt qã / Ìä=º2.

  !

“~ PCR-DBH sensitivity/ šåa =h purified AlHV-1 DNA/ :¿ æç=h ƒƒE membrane

 ,¡ ¼ PCR-DBH/ ¢]=º2. ,¡ AlHV-1 DNA ÓÔf ƒƒ 10⁸, 10⁷, 10⁶, 10⁵, 10⁴, 10³, 10², 10¹ pg DNA/ Si l–2. f CDˆÒfE C500- 1/C500-2 primer ÑE ¡=h, PCRE MN ¼ ¨ €

!†|E nylon membrane ,¡ ¼, ± DIG- labeled probe hybridization £E >*, ut qã/ NBT/BCIP ~ßtH I=º2. m), PCR-DBH specificity/ I=a =h AlHV-1

€ è homology/ Si lJ Í gamma herpesvirus group é=J ovine herpesvirus 2 (OvHV- 2), bovine herpesvirus 4 (BHV-4) DNA/ p=h, PCR-DBH/ MN=h specificity/ I=º2. PCR : ê MN sensitivity/ šåz, :¿ æç purified AlHV-1 DNA ÓÔf 10⁸, 10⁷, 10⁶, 10⁵, 10⁴, 10³, 10², 10¹ pg DNA/ Si C500-1/C500-2 primer ) PCRE MN ¼, ethidium bromide/ q) 2% agarose gel #aë‘E ) ¼ UV 404 bp Ða €

!†| qã/ I=º2. m), DBH :ê MN

sensitivity/ šåz, purified AlHV-1 DNA/ :¿

æç purified AlHV-1 DNA ÓÔf 10⁸, 10⁷, 10⁶, 10⁵, 10⁴, 10³, 10², 10¹ pg DNA/ Si ƒƒE FG nylon membrane dot blotH ,¡ ¼ DIG-labeled probe 3]^ hybridizationE ¢]=h, DBH :ê MN ž6 v/ ìS=º2.



"#$%  

Non-radioacive probe/ ¡) PCR-DBH ., 1 pg purified AlHV-1 DNA Ëiv Cp‰ M l–2

(Fig. 1). f t 345 X èE M» 2 í) tH 9) áâß t .|E Ìä‰ M l–2(Fig. 1). “~ PCR-DBH uv/ I=a

=h, AlHV-1 Í gamma herpesvirus group é

=J OvHV-2, BHV-4 345 €E D¡=h PCR- DBH/ ¢]) ., ,¡ AlHV-1 í) X• t E ºH?, OvHV-2 BHV-4 J t ÌäOi

°å, uvS —˜ Ÿ¤E š M l–2(Fig. 2).

 &'( "#$ &'% 

PCR :ê MN ) ž6v/ ìS) ., C500- 1/C500-2 primer ÑE D¡) PCR 10² pg purified AlHV-1 DNAËi Cp‰ M l–2 (Fig. 3). f t  ethidium bromide/ q) 2% agarose gel #a ë‘E ) ¼ UV 404 bp Ða îï ÌäO–

H, 345 X èE M» 2 ðñ´ îï ÌäO–, PCR :ê MNHJ 10 pg 1 pg

purified AlHV-1 DNA/ Cp‰ M ò¤E š M l–2 (Fig. 3). m), DBH :ê MN ) ž6v/ ìS) ., DBH :êHJ 10⁴ pg purified AlHV-1 DNA Ëi Cp‰ M l¤E š M l–2 (Fig. 4). f  t AlHV-1 DNA X èE M» 2 í) tH 9) áâß t .|E Ìä‰ M l–, 10³, 10² Fig. 1. PCR-dot blot hybridization of AlHV-1. 1, PCR amplicon of 10⁸ pg; 2, PCR amplicon of 10⁷ pg; 3, PCR amplicon of 10⁶ pg; 4, PCR amplicon of 10⁵ pg; 5, PCR amplicon of 10⁴ pg; 6, PCR amplicon of 10³ pg; 7, PCR amplicon of 10² pg; 8, PCR amplicon of 10 pg; 9, PCR amplicon of 1 pg.

Fig. 2. Specificity of PCR-dot blot hybridization of AlHV- 1. The AlHV-1 probe was not reacted with other gamma herpesviruses, OvHV-2 and BHV-4, which have high homology in their sequences. However, PCR-DBH using AlHV-1 template DNA resulted in strong positive signal. 1, AlHV-1 DNA; 2, OvHV-2 DNA; 3, BHV-4 DNA.

" 1 pg purified AlHV-1 DNAJ Cp=i ó=º 2(Fig. 4).

ôˆËi, AlHV-1 9: 345 u€E I=J PCR KL ‡=h Q2 [11, 17]. R4?,

· ' , C500-1/C500-2/ D¡) AlHV-1 PCR 10 pg = purified AlHV-1 DNA/ Cp=i ó=º 2. AlHV-1 gamma herpesvirus , z² ›œ6 E q~=a bc, nFo —˜ ™ ³v ‡ˆ)2 [2, 17]. 4), q bc AlHV-1 9:LHJ Ÿ

ž6v/ S9 KL `'OP92. ôˆËi  < 

¡OJ PCR ±r, Ÿ ž6v/ Si lJ KL

iõ, · ' . š M lö, ÷Œ¹

AlHV-1 Cp )¿/ Si l¤E š M l–2.

Outer primer ÑE ¡) PCR ¼, inner primer ÑE

¡) ð øù PCR £E >*J nested PCR ú

, PCR ±=h, ž6v/ Ÿú M lJ KLH

š«¬ lP, AlHV-1 ž6v/ ŸJ KLH m)

¡OPg M lE ª2. R4?, nested PCR R MN£ A [  z² ~{=h X• .S q~w M l¤ z² O l2 [5, 9, 10, 16]. ·

'J —˜ Ÿ ž6vS `'OPiJ AlHV-1 9:

LE “~=z MNO–H, R . Ÿ ž6 v uv/ ûJ PCR-DBH/ “~=º2. “~

PCR-DBHJ PCRE MN ¼, DIG-labeled probe/ D¡

=h, hybridizationE >*a bc, nested PCR ±r

=h, —˜ Ÿ uv/ I‰ M l2. 345 €

 CpE ) hybridization ³²P mJ ³H ü KD

„‘Œ/ Ái) probe/ D¡=h CDS è M NOiõ, f KD„ ‘ŒJ ýþ YZJ Ê

 ÿ<£ è P«
 l2 [4]. Yµ , · '

 J non-radioactive probe/ D¡) probe/ D¡=

z =ºH, h4 non-radioactive material A, ôˆ  

< ¡OlJ DIGE ¡=h, probe/ Ái=º2.

]Ê D¡ non-radioactive DIGE Ái) probeJ ]Ê . uvS —˜ Ÿå, AlHV-1 345

€ è homology/ Si lJ, Í gamma herpesvirus group OvHV-2 " BHV-4 DNA t

=i °Î2. Yµ , · '/ §=h “~ AlHV-1

 PCR-DBHJ ôˆ AlHV-1 9:LH qú=¥ 

¡O lJ PCR h4 cjfE ¶.¶  M l J H ¡w M lE ªH aOP92.

 

AlHV-1 gamma herpesvirus , z² ›œ6 E q~=a bc, nFo —˜ ™ ³v ‡ˆ)2.  4), q bc AlHV-1 9:LHJ Ÿ ž6v / S9 KL `'OP92. · 'J —˜ Ÿ ž 6vS `'OPiJ AlHV-1 9:LE “~=z M NO–H, R . Ÿ ž6v uv/ ûJ PCR-DBH/ “~=º2. “~ PCR-DBHJ PCRE M N ¼, DIG-labeled probe/ D¡=h, hybridizationE >

*a bc, nested PCR ±r=h, —˜ Ÿ uv / I‰ M l2. · '/ §=h “~ AlHV-1

PCR-DBHJ ôˆ AlHV-1 9:LH  < ¡O

lJ PCR h4 cjfE ¶.¶ M lJ H  ¡w M lE ªH aOP92.

Fig. 3. Gel electrophoresis of amplicons by AlHV-1 PCR using primer C500-1 and C500-2. M, 100-bp DNA ladder;

P, Positive control; N, Negative control; 1, 10⁸ pg AlHV- 1 DNA; 2, 10⁷ pg AlHV-1 DNA; 3, 10⁶ pg AlHV-1 DNA;

4, 10⁵ pg AlHV-1 DNA; 5, 10⁴ pg AlHV-1 DNA; 6, 10³ pg AlHV-1 DNA; 7, 10² pg AlHV-1 DNA; 8, 10¹ pg AlHV- 1 DNA; 9, 1 pg AlHV-1 DNA.

Fig. 4. Hybridization was performed with digoxigenin- labeled AlHV-1 DNA probe. Hybrids were detected by an antibody-conjugate (anti-digoxigenin-alkaline phosphatase conjugate) and subsequent enzyme-catalyzed color reaction with 5-bromo-4-chloro-3-indolyl phosphate (BCIP) and nitro blue tetrazolium salt (NBT). 1, 10⁸ pg AlHV-1 DNA;

2, 10⁷ pg AlHV-1 DNA; 3, 10⁶ pg AlHV-1 DNA; 4, 10⁵ pg AlHV-1 DNA; 5, 10⁴ pg AlHV-1 DNA; 6, 10³ pg AlHV- 1 DNA; 7, 10² pg AlHV-1 DNA; 8, 10¹ pg AlHV-1 DNA;

9, 1 pg AlHV-1 DNA.

 

1. Biesiadecka, A. and Litwinska, B. Application of polymerase chain reaction for the detection of herpes simplex virus DNA. Acta Microbiol. Pol. 1997, 46, 405-408.

2. Brigen, A., Munro, R. and Reid, H. W. The detection of Alcelaphine Herpesvirus-1 DNA by in situ hybridization of tissues from rabbits affected with malignant catarrhal fever. J. Comp. Pathol. 1992, 106, 351-359.

3. Broketa, M., Vince, A. and Drazenovic, V. Non- radioactive digoxigenin DNA labeling and immunologic detection of HSV PCR products. J. Clin. Virol. 2001, 23, 17-23.

4. Chen, Y., Chen, Y., Lii, H. and Lu, Z.

Chemiluminescence detection of Epstein-Barr virus DNA with an oligonucleotide probe. Clinica. Chimica.

Acta. 2000, 298, 45-53.

5. Cimino, G. D., Metchette, K. C. and Tessman, J. W.

Post PCR sterilization: a method to control carry-over contamination for the polymerase chain reaction.

Nucleic Acids Res. 1990, 19, 99-107.

6. Duggan, M. A., Inoue, M. and McGregor, S. E. A paired comparison of dot blot hybridization and PCR amplification for HPV testing of cervical scrapes interpreted as CIN 1. Eur. J. Gynaecol. Oncol. 1994, 15, 178-187.

7. Ensser, A., Pflanz, R. and Fleckenstein, B. Primary structure of the alcelaphine herpesvirus 1 genome. J.

Virol. 1997, 71, 6517-6525.

8. Hwang, S. J., Lee, S. D. and Lu, R. H. Comparison of three different hybridization assays in the quantitative measurement of serum hepatitis B virus DNA. J. Virol.

Methods. 1996, 62, 123-129.

9. Kwok, S. and Higuchi, R. Avoiding false positives with PCR. Nature. 1989, 339, 237-238.

10. Levy, R., Najioullah, F. and Thouvenot, D. Evaluation and comparison of PCR and hybridization methods for rapid detection of cytomegalovirus in clinical samples.

J. Virol. Methods. 1996, 62, 103-111.

11. Li, H., Dyer, N. and Keller, J. Newly recognized herpesvirus causing malignant catarrhal fever in white- tailed deer (Odocoileus virginianus). J. Clin. Microbiol.

2000, 38, 1313-1318.

12. McNicol, A. M. and Farquharson, M. A. In situ hybridization and its diagnostic applications in pathology. J. Pathol. 1997, 182, 250-261.

13. Muller-Doblies, U. U., Li, H. and Hauser, B. Field validation of laboratory tests for clinical diagnosis of sheep-associated malignant catarrhal fever. J. Clin.

Microb. 1998, 36, 2970-2972.

14. Patel, J. R. and Edington, N. The detection of the Herpesvirus of bovine malignant fever in rabbit lymphocytes in vivo and in vitro. J. Gen. Virol. 1980, 48, 437-444.

15. Plowright, W. Malignant catarrhal fever virus, Virus Infections of Ruminants. pp. 123-150, Elsevier, New York, 1990.

16. Porter-Jordan, K., Rosenberg, E. I. and Keiser, W.

F. Nested polymerase chain reaction assay for the detection of Cytomegalovirus overcomes false positives caused by contamination with fragmented DNA. J.

Med. Virol. 1990, 30, 85-91.

17. Schock, A. and Reid, H. W. Characterisation of the lymphoproliferation in rabbits experimentally affected with malignant catarrhal fever. Vet. Microb. 1996, 53, 111-119.

18. Xia, J. Q., Yason, C. V. and Kibenge, F. S.

Comparison of dot blot hybridization, polymerase chain reaction, and virus isolation for detection of bovine herpesvirus-1 (BHV-1) in artificially infected bovine semen. Can. J. Vet. Res. 1995, 59, 102-109.