• 검색 결과가 없습니다.

줄기세포는 배아줄기세포 (embryonic stem cells), 성체

N/A
N/A
Protected

Academic year: 2021

Share "줄기세포는 배아줄기세포 (embryonic stem cells), 성체"

Copied!
8
0
0

로드 중.... (전체 텍스트 보기)

전체 글

(1)

전기 자극을 이용한 CD271 양성 중간엽줄기세포의 연골세포 분화능

정소연, 이세아, 구나연, 임성인, 이지현*, 이윤희, 현방훈

Chondrogenic Differentiation Potential of CD271 Positive Mesenchymal Stem Cells through Electrical Stimulation

So Yeon Jeong, Se-A Lee, Na-Yeon Gu, Seong-In Lim, Jienny Lee*, Yoon-Hee Lee, and Bang-Hun Hyun

Received: 24 February 2021 / Revised: 23 March 2021 / Accepted: 26 March 2021

© 2021 The Korean Society for Biotechnology and Bioengineering

Abstract: Mesenchymal stem cells (MSCs) exhibit self-renew- ing capacity and multi-lineage differentiation potential. CD271 has been identified as a marker of the most homogeneous MSCs subset. In this study, we separated CD271 positive MSCs (CD271-MSCs) from canine adipose tissue-derived MSCs (AD-MSCs) using immunomagnetic selection method. Both CD271-MSCs and AD-MSCs showed similar morphology and expressed common immunophenotypic markers (CD34, CD44, and CD45). However, CD271-MSCs and AD-MSCs exhibited difference in chondrogenic differentiation potential. Specifi- cally, CD271-MSCs exhibited increased expression levels of chondrocyte specific markers, collagen type II alpha 1 (COL2A1) and Aggrecan compared to AD-MSCs. Also, electrical stimula- tion (ES)-treated CD271-MSCs have a greater capacity for expressing heat shock protein 70 (HSP70), COL2A1, and Aggrecan compared to control without exogenous differentia- tion condition. This study might contribute to the differentiation potential of homogenous MSCs into cartilage cells by specific ES condition in the absence of exogenous differentiation agents.

Keywords: mesenchymal stem cells, CD271, electrical stimula- tion, differentiation potential

1. INTRODUCTION

줄기세포는 배아줄기세포 (embryonic stem cells), 성체

줄기세포 (adult stem cells), 유도만능줄기세포 (induced pluripotent stem cells)로 나뉘며, 성체줄기세포는 중간엽 줄기세포 (mesenchymal stem cells), 조혈모세포 (hemato- poietic stem cells) 등이 있다 [1]. 이 중, 중간엽줄기세포는 골수, 탯줄, 지방조직과 같은 다양한 조직으로부터 분리 가 가능하고 자가 재생 (self-renewal) 능력을 가지고 있으 며 [2-5], 지방세포 (adipocytes), 연골세포 (chondrocytes), 골세포 (osteocytes), 근육세포 (myocytes), 신경세포 (neurons) 등 중배엽, 외배엽, 내배엽 계통으로 분화할 수 있다 [6, 7]. 중간엽줄기세포는 이러한 분화능을 기반으로 다양한 세포치료 연구에 활용되고 있으며, 재생이 제한되었거나 불가능한 조직의 치료 연구에서 그 가치가 더욱 높다.

미국 질병통제예방센터 (Centers for Disease Control and Prevention)는 2013~2015년 통계자료에서 대표적인 연골 질환인 골관절염으로 진단받은 사람이 연간 5천만 명이 고 2천만 명 이상은 이로 인해 일상활동에 제약이 있다고 보고하였다 [8]. 또한, 우리 건강보험심사평가원도 2018~

2019년 통계자료에서 연간 2백만 명 이상이 골관절염 진 단을 받고 있으며, 해마다 그 수가 증가하고 있다고 보고 하였다. 이처럼 연골질환은 현대인의 삶에 큰 영향을 미 치고 있다 [9]. 재생 불가능한 대표적인 조직인 연골은 세 포 밀도가 낮은 세포외기질 (extracellular matrix)로 이루 어지며, 기질의 비정상적인 변화는 조직에 영향을 미치게 되고 질병의 발병 및 진행에 중요한 역할로 이어진다 [10]. 연골은 다양한 부위에 존재하고 조직과 달리 혈관, 신경, 림프관이 없으며, 연골세포라고 불리는 밀집된 세 포외기질로 구성된다. 세포외기질은 주로 물, 콜라겐 (collagen), 프로테오글리칸 (proteoglycan)으로 구성되며, 비 콜라겐성 단백질과 당 단백질이 소량 존재한다 [11- 13]. 특히, 관절 내 연골은 기계적 하중을 견디고 충격을 흡수하는 표면을 제공하여 관절 내 뼈 사이의 마찰을 감

These authors contributed equally to this work.

농림축산검역본부 바이러스질병과

Viral Disease Research Division, Animal and Plant Quarantine Agency, Gimcheon 39660, Korea

Tel.: +82-54-912-0809, Fax: +82-54-912-0812 E-mail: [email protected]

Research Paper

(2)

소시키는 주요한 기능을 한다. 이러한 연골 손상에 대한 치료를 위하여 중간엽줄기세포 등을 활용하는 다양한 연 구들이 시도되고 있다 [14,15].

CD271 은 nerve growth factor receptor로 low-affinity nerve growth factor receptor로도 알려져 있으며, 균일한 중간엽줄기세포 하위집합과 관련이 있다 [16-18]. Kohli 등은 중간엽줄기세포에 비해 CD271 양성 중간엽줄기세 포가 연골 형성에 우수하며, 중간엽 계통을 따라 세포 증 식과 분화를 촉진하여 연골세포의 분화에 우수하다고 보 고하였다 [19]. Galabrese 등도 CD271 양성 골수 및 지방 조직 유래 중간엽줄기세포가 CD271 음성 중간엽줄기세 포에 비해 세포 증식 및 연골세포로의 분화가 우수하다고 보고한 바 있다 [20].

기존의 세포치료제는 세포의 특성 조절을 위해 유전자 도 입이나 생화학적 인자들을 사용하여 왔다. 반면, 빛, 온도, 전기 등 물리적 인자들은 그 생물학적 기능에 있어서 많은 주목을 받지 못했다. 최근 다양한 연구에서 세포는 물리적 인자들을 인지하는 기능을 가지고 있고, 체내의 세포는 세 포막에 위치한 수용체 이온 채널을 통해 전기적, 화학적, 기 계적 신호 등을 감지할 수 있다고 보고되었다 [21-24]. 이러 한 물리적 인자 중, 전기는 세포를 이용한 연구분야에서 유 전자 도입이나 생화학적 인자 투여를 보조하기 위한 수단 으로 사용되어 왔다. 최근 전기를 기반으로 하는 물리학적 접근법이 퇴행성 질환 등에 활용되기 시작했다. 체내에서 의 생리과정은 관절 내 연골에 자연적인 내인성 전기 신호 발생을 유도하고 세포외기질 관련 유전자의 발현과 염증 매개체의 생성 감소를 통해 연골 손상 방어에 대한 가능성 이 있다고 보고되고 있다 [25-28]. 즉, 자가 재생 능력을 가 진 중간엽줄기세포를 대상으로 미세한 전기를 자극하여 내 인성 전기 신호를 자극하는 전략은 연골 손상에 대한 회복 연구에 도움이 될 수 있다. 본 연구에서는 개 지방조직 유래 중간엽줄기세포로부터 CD271 양성세포를 분리하고 이에 물리적 인자인 전기 자극을 접목하여 더욱 효과적인 연골 세포 분화능을 유도하고 그 결과를 고찰하였다.

2. MATERIALS AND METHODS

2.1. 개 지방조직 유래 중간엽줄기세포 분리 및 배양 개 복부 피하로부터 지방조직을 수집한 다음 penicillin (300 U/mL, Gibco, USA)과 streptomycin (300 μg/mL, Gibco, USA) 이 포함된 dulbecco’s phosphate buffered saline (DPBS; Gibco, USA)으로 2회 세척하였다. 멸균된 가위를 이용하여 조직을 잘게 자른 후, 0.1% collagenase type I (Gibco, USA)과 1% bovine serum albumin (Bioworld, USA)이 포함된 DPBS를 넣고 37

o

C에서 60분간 반응하였 다. 100 μm cell strainer (BD Falcon, USA)로 조직 부유물 을 거르고 1,500 rpm에서 5분간 원심 분리하여 상층액을 제거한 후 pellet에 10% fetal bovine serum (Gibco, USA),

penicillin (100 U/mL), streptomycin (100 μg/mL)이 포함된 low glucose dulbecco’s modified Eagle’s medium (Gibco, USA)을 넣고 잘 섞은 다음, 175 T-flask에 1 × 10

6

개 세포 를 분주하여 5% CO

2

, 37

o

C 의 배양기에서 배양하였다. 다 음 날 배양액을 교체하고 2일 간격으로 배양액을 교체하 며 세포의 밀집도가 80%에 도달하면 0.25% Trypsin- EDTA (Gibco, USA)를 처리하여 다음 계대로 세포를 배 양하였다.

2.2. Magnetic activated cell sorting (MACS) 방법을 이용 한 CD271 양성세포 분리

개 지방조직 유래 중간엽줄기세포를 CD271 (Cat. 130- 099-023, Miltenyi Biotec, Germany) 항체를 이용하여 CD271 양성세포를 분리하였다. 자석 부착대 (magnetic body)에 자석을 부착시키고 컬럼을 고정한 다음 MACS buffer로 1 회 세척한 뒤 CD271 항체가 부착된 세포를 컬럼에 통과 시켜 CD271 음성세포를 분리하였다. CD271 음성세포를 분리한 다음 잔류하는 CD271 양성세포를 분리하고자 컬 럼을 자석 부착대와 분리하여 MACS buffer를 첨가하고 플런저로 밀어서 CD271 양성세포를 분리하였다.

2.3. 중간엽줄기세포의 세포 표면 특이 단백질 분석 및 연 골세포 분화 유도

개 지방조직 유래 중간엽줄기세포 및 CD271 양성세포의 세포 표면 특이 단백질의 발현을 확인하고자 0.25%

Trypsin-EDTA를 처리하여 세포를 탈착한 다음 DPBS로 2 회 세척하였다. 5 × 10

5

개의 세포에 형광물질이 결합된 mouse anti-dog CD34 (PE; 59369, BD Pharmingen, USA), mouse anti-dog CD44 (PE; MAB5549, R&D Systems, USA), rat anti-dog CD45 (FITC; MCA1042F, AbD serotec, UK) 항체를 넣고 1시간 동안 반응한 다음 DPBS로 2회 세 척한 뒤 FACS Calibur™flow cytometer (Becton Dickinson, USA)를 이용하여 Cell Quest Pro (Becton Dickinson, USA) 프로그램으로 결과를 분석하였다. 또한, 개 지방조직 유래 중간엽줄기세포 및 CD271 양성세포의 중배엽 세포로의 분 화 능력을 비교하고자 연골세포 분화를 위해 4-well plate에 well 당 5 drop (5 × 10

4

cells/drop) 을 형성하고 3-4시간 동안 군락을 형성한 다음 연골세포 분화용 시약 (Dexamethasone, Sigma-Aldrich, USA; L-ascorbic acid 2-phosphate, Sigma- Aldrich, USA; TGF-β3, Lonza, Switzerland)으로 분화를 유도하였다. 21일 후에 DPBS로 2회 세척한 다음, 4%

paraformaldehyde (Sigma-Aldrich, USA) 로 30분간 고정하고 분화 확인을 위한 염색용 시약인 Alcian blue (IHC World, USA)을 이용하여 연골세포로의 분화능을 확인하였다.

2.4. 정량적 중합효소연쇄반응 (quantitative real-time reverse transcriptase-polymerase chain reaction, qPCR) 을 이용한 유전자 분석

연골세포 분화 및 전기 자극 관련 특이 유전자 발현을 확

(3)

인하고자 RNeasy mini kit (Qiagen, USA)를 이용하여 RNA를 추출하고 Nano-drop 1000 (Thermo, USA)으로 RNA 순도와 농도를 측정한 다음 GoScript™Reverse Transcriptase (Promega, USA)를 사용하여 cDNA를 합성 하였다. 96-well plate에 LightCycler

®

480 SYBR Green I Master Mix (Roche Diagnostics, USA) 를 사용하여 pre- denaturation (95

o

C, 10분), annealing (60

o

C, 10초), elongation (72

o

C, 10초)을 45 cycle 반복하였다. 2

−Δ

Ct 계산법을 이용 하여 melting curve를 분석하였고, β-actin을 reference gene 으로 이용하여 qPCR 결과를 분석하였다. 사용한 primer 의 정보와 조건은 Table 1에 나타내었다.

2.5. CD271 양성세포의 3차원 고밀도 응집 형성

CD271 양성세포에 전기 자극을 가하기 위하여 세포를 고 밀도로 응집하여 마이크로매스 (micromass)를 형성하였 다. 2.5 × 10

5

개 세포를 준비하여 세포 배양액 (10 μL)에 고밀도로 희석한 후, 35 mm culture dish에 부착한 다음 2시 간 동안 마이크로매스 형성을 유도하였다.

2.6. CD271 양성세포 전기 자극 및 연골세포 특이 유전자 분석

CD271 양성세포를 고밀도로 응집하여 마이크로매스를 형성하였다. 기존에 보고된 연구 결과 [29,30]를 참고하여 3 일간 전기 (10 V/cm, 10 ms, 2 Hz)를 자극하였으며, 연골 세포 특이 유전자인 collagen type II alpha 1 (COL2A1), Aggrecan 및 연골 형성에 도움을 주는 유전자인 heat shock protein 70 (HSP70)의 발현을 분석하였다.

2.7. 통계학적 분석

독립적인 3회 (n=3)의 실험을 수행하여 그 결과를 평균과 표준편차 (mean ± SD)로 표시하여 나타내었으며, 통계는 Sigma Plot 12.0 (Systat Software, Germany)를 이용하여 분석하였다. 두 실험군 사이의 유의성은 Student t-test 및 Mann-Whitney rank sum test 법으로 검정하여 유의성 있 는 결과 (p < 0.05)를 판정하였다.

3. RESULTS AND DISCUSSION

3.1. 개 지방조직 중간엽줄기세포와 CD271 양성세포 성 상 및 특성 분석

CD271은 중간엽줄기세포의 균일성을 위한 마커로 알려 져 있다 [16]. 개 지방조직으로부터 분리한 중간엽줄기세 포를 MACS 방법을 이용하여 CD271 양성세포를 분리하 였다. 중간엽줄기세포와 CD271 양성세포는 유사한 방추 형을 나타내었다 (Fig. 1(a)). 세포 표면 특이 단백질 발현 을 확인하고자 유세포 분석을 수행한 결과, 중간엽줄기세 포와 CD271 양성세포는 CD44를 발현하였으며, CD34와 CD45는 발현하지 않았다 (Fig. 1(b)). 중간엽줄기세포와 CD271 양성세포의 세포 표면 단백질 발현에서는 큰 차이 가 없었다.

Beckenkamp 등은 사람 지방조직으로부터 분리한 중간 엽줄기세포를 CD271 양성세포와 음성세포로 분리하여 두 가지 세포가 방추형의 유사한 형태를 나타낸다고 보고 하였다 [31]. Kohli 등도 사람 지방조직으로부터 분리한 중간엽줄기세포와 CD271 양성세포의 유세포 분석을 비 교하였다. 두 가지 세포 모두 CD73, CD90, CD105를 발현 하였고 CD34와 CD45는 발현하지 않았으며 유사한 특성 을 가진다고 보고한 바 있다 [19]. Calabrese 등도 사람의 골수와 지방에서 분리한 중간엽줄기세포를 CD271 양성 세포와 음성세포로 분리하여 유세포 분석을 비교하였다.

그 결과, CD73, CD90, CD105의 발현은 유사한 반면 CD34와 CD45의 발현은 CD271 양성세포에서 음성적으 로 발현됨을 확인하여 CD271은 중간엽줄기세포의 차이 를 보여주는 유일한 마커라 보고한 바 있다 [20]. 본 연구 의 개 지방조직 유래 중간엽줄기세포와 CD271 양성세포 의 성상 및 세포 표면 단백질 분석에서 큰 차이는 없었다.

3.2. 개 지방조직 중간엽줄기세포와 CD271 양성세포의 연 골세포 분화능 비교

개 지방조직 중간엽줄기세포와 CD271 양성세포를 연골 세포로 분화 유도하여 두 가지 세포에서 연골세포 특이 마 커인 연골 기질의 염색을 확인하였다. 특히, CD271 양성 Table 1. Primers sequences for qPCR

Gene Primer sequence (5’-3’) PCR product size (bp) Annealing Tm (

o

C)

HSP70 F : CAAGATCACCATCACCAACG

R : CCTCGGCTTTGTACTTCTCG 89 60

Aggrecan F : CCAACTATCTCCCTCGTGGA

R : ACTGCCCCACTAATGTCCAG 149 60

COL2A1 F : TCCTTCTGGTGAACCTGGAC

R : ACCACGATCACCCTTGACTC 91 60

β-actin F : GCTACGTCGCCCTGGACTTC

R : GCCCGTCGGGTAGTTCGTAG 86 60

HSP70; heat shock protein 70, COL2A1; collagen type II alpha 1

(4)

세포는 세포 응집능이 우수하여 뚜렷한 염색이 관찰되었 다 (Fig. 2(a)). 또한, qPCR을 수행하여 연골세포로 분화 유 도한 세포에서 연골세포 특이 유전자 발현을 비교한 결과, 분화를 유도하지 않은 대조군에 비해 중간엽줄기세포와 CD271 양성세포에서 연골세포 특이 마커인 Aggrecan의 발현이 유의하게 증가하였으며, COL2A1은 CD271 양성 세포에서 유의하게 증가하는 것을 확인하였다 (Fig. 2(b)).

Calabrese 등은 CD271 양성 중간엽줄기세포는 음성에 비 해 세포 증식과 지방세포, 골세포, 연골세포로의 분화능이 우수함을 보고하였다 [20]. 또한, Mifune 등은 동물실험을 통 해 CD271의 발현과 연골 형성 사이의 상관 관계를 조사하였 다. 대조군에 비해 CD271 양성세포가 연골 형성에 영향을

미치는 것을 확인하였으며, 연골 형성 관련 유전자인

Aggrecan, COL2A1, SOX9 의 높은 발현은 체내 및 체외에서

연골세포의 형성에 우수함을 보고하였다 [32]. Aggrecan과

COL2A1은 연골세포의 생존과 연골 기질을 유지하는데 매

우 중요하다 [13]. Aggrecan은 관절 내 연골에서 세포외기질

을 구성하는 프로테오글리칸의 핵심 단백질이며, 프로테오

글리칸 내의 glycosaminoglycans는 연골조직 수분 공급, 연

골세포 성숙 및 기능에 중요한 성장 인자와의 결합을 가능하

게 하며, COL2A1은 근육, 관절, 기관 및 피부를 지지하는 결

합 조직을 구성한다 [33]. Nejadnik 등은 in vitro에서 지방조직

유래 중간엽줄기세포의 연골 형성능을 수정 평가하고자 중간

엽줄기세포를 연골세포로 분화 유도하여 COL2A1, Aggrecan,

Fig. 1. Isolation and characterization of CD271 positive MSCs (CD271-MSCs) from canine adipose tissue-derived mesenchymal stem

cells (AD-MSCs). (a) Morphology of AD-MSCs and CD271-MSCs (40 ×, 100 ×). (b) Flow cytometry histograms show the positively

expressed CD44, but CD34 and CD45 were negatively expressed at P5. AD-MSCs and CD271-MSCs displayed expression of similar

surface markers (CD34, CD44, and CD45).

(5)

SOX9의 발현이 증가하는 것을 확인하였으며, 염색을 통해 연골 조직 형성 및 프로테오글리칸의 생성을 확인한 바 있다.

[34].

3.3. CD271 양성세포 전기 자극 및 연골세포 특이 마커 분석 관절 내 연골세포는 전압계 칼슘 채널을 보유하는 것으로 알려져 있다 [23]. Boileau 등은 개 골관절염 모델에서 칼 슘 채널 억제제 (PD-0200347)를 이용하여 골관절염의 발 달이 지연되는 것을 보고하였다 [35]. 본 연구를 통해 연 골세포 분화 우수성을 확인한 CD271 양성세포를 대상으 로 고밀도의 3차원 세포 형성을 유도하고 3일간 미세한 전기 (10 V/cm, 10 ms, 2 Hz)를 자극하여 연골세포 분화 특이 유전자 발현을 조사하였다. 그 결과, 대조군에 비해 3일간 전기를 자극한 실험군에서 연골세포 형성에 관여 하는 단백질인 HSP70의 발현과 연골세포 특이 마커인 Aggrecan, COL2A1의 발현이 유의적으로 증가함을 확인 하였다 (Fig. 3).

물리적, 화학적 스트레스뿐만 아니라 열 스트레스를 받 는 세포에서 발현되는 열 충격 단백질인 HSP70은 세포의 발달, 성장 및 분화에 중요한 역할을 하는 것으로 알려져

있다. HSP70은 연골세포에서 프로테오글리칸 핵심 단백질 을 생산하고 연골세포의 사멸을 억제한다 [11,12]. Otsuka 등은 열 자극에 의한 연골세포의 분화 말기에 HSP70이 발현된다고 보고하였으며 [36], Son 등은 HSP70이 전기 자극에 의한 연골세포의 세포괴사를 보호할 뿐만 아니라 관절조직에서의 과발현은 연골질환으로 인한 연골 파괴 를 보호한다고 보고한 바 있다 [37]. 또한, Tsuchida 등은 HSP70의 과발현은 연골세포의 대사 활동을 향상시키고 열 스트레스로부터 연골세포를 보호한다고 보고하였다 [38].

이러한 HSP70은 세포외기질의 mRNA 발현과 연골세 포의 생존력을 증가시키고 SOX9과 상호작용하여 COL2A1 및 Aggrecan과 같은 연골 기질 유전자를 직접 조절한다 [38]. Li 등은 사람 골수 유래 중간엽줄기세포에 가벼운 열 충격을 가해 HSP70의 발현 증가가 골과 연골 형성에 필수적인 역할을 하는 것을 확인하였으며, HSP70의 억제 는 골세포 형성 특이 마커인 alkaline phosphatase의 활성, Runx2, Osterix 및 연골세포 형성 특이 마커인 COL2A1의 발현 감소를 나타내었다 [39]. Kwon 등은 마우스 골수 유 래 중간엽줄기세포에 3일간 전기 자극을 가해 Aggrecan, Fig. 2. Differentiation potential of AD-MSCs and CD271-MSCs. (a) AD-MSCs and CD271-MSCs were cultured in chondrogenic medium for up to 21 days. Chondrogenesis were demonstrated by Alcian blue (chondrogenesis; 200 ×). (b) Expression of differentiation markers (COL2A1 and Aggrecan) in chondrogenesis by qPCR (*p < 0.05, **p < 0.01, ***p < 0.001). UN; undifferentiated, DIF;

differentiated

(6)

COL2A1, SOX9과 같은 연골세포 특이 마커의 발현을 조 사하였으며 그 결과, 분화 유도배지를 이용한 대조군에 비해 전기 자극한 실험군에서 효과적이었음을 보고하였 다 [40]. Xu 등도 소 관절 내 연골 세포에 전기 자극을 가 하여 연골 기질 관련 단백질인 Aggrecan과 COL2A1이 발 현함을 확인하였으며, 연골세포 내 증가된 칼슘이온은 calcineuin/ NF-AT (nuclear factor of activated T-cells) 신호 전달 경로를 통해 연골 형성을 유도한다고 보고한 바 있 다 [23]. 본 연구에서도 대조군에 비해 3일간 전기를 자극 한 실험군에서 Aggrecan과 COL2A1의 유의성있는 발현 을 확인하였다. 이는 물리적 인자인 전기 자극만으로 중 간엽줄기세포의 연골세포 분화가 가능함을 의미한다 [24,32].

연골세포는 전체 연골의 5% 정도를 차지하지만 혈관이 나 신경이 없는 상태에서 매트릭스를 유지하는 데 중요한 역할을 한다. Vaca-González 등은 다양한 연골조직의 손 상을 복구하고자 사람 및 동물의 연골세포 또는 연골조 직에 전기 자극 및 기계 자극 등 여러 가지 자극을 시도하 였다 [41]. Wang 등은 소 관절 내 연골세포에 균일한 강도 의 전기 자극을 가해 연골세포와 연골조직의 분화에 유

효하다고 보고하였으며 [29], Brighton 등은 소의 연골조 직 샘플을 이용하여 20 mV/cm로 전기를 자극하여 대조 군에 비해 Aggrecan과 COL21A의 발현이 증가한 것을 보 고하였다 [30]. Xu 등도 소의 관절 내 연골세포에 다양한 조건의 전기를 자극하여 프로테오글리칸과 콜라겐의 증 가를 확인하였으며, Aggrecan과 COL2A1 유전자와 단백 질 발현 증가 및 metalloproteinase 억제를 보고하였다 [23]. Metalloproteinase 활성 조절은 골관절염을 치료하는 데 중요한 역할을 한다고 알려져 있다 [23]. 이처럼 연골 세포는 전기를 포함한 다양한 화학적, 물리적 신호에 반 응하며, 특히 전기는 체내의 정상적인 생리 기능을 유지 하는 데 도움을 주며 더 나아가 최적의 조건에서 중간엽 줄기세포의 특정 세포 분화에 도움을 줄 수 있다 [42].

4. CONCLUSION

개 지방조직으로부터 성공적으로 분리한 CD271 양성세 포는 음성세포에 비해 연골세포로의 분화능이 우수하였 다. 이러한 CD271 양성세포를 대상으로 3일간 미세한 전 Fig. 3. Condensation and chondrogenic differentiation potential of CD271-MSCs. (a) Condensation behaviors of CD271-MSCs in micromass culture were examined using phase contrast images during culture for 3 days under ES (10 V/cm, 10 ms, 2.0 Hz). (b) mRNA expression levels of HSP70, COL2A1, and Aggrecan were analyzed by qPCR. ES enhances mRNA expression of chondrogenic markers in CD271-MSCs. β-actin was used as a housekeeping gene and all RNA data were normalized to levels of β-actin (*p < 0.05,

**p < 0.01, ***p < 0.001). ES; electrical stimulation, W/O; without, W; with

(7)

기 (10 V/cm, 10 ms, 2 Hz)를 자극하여 연골세포 분화 특 이 유전자 발현을 조사하였으며, 대조군에 비해 전기를 자극한 실험군에서 연골세포 형성에 관여하는 단백질인 HSP70 과 연골세포 특이 마커인 COL2A1, Aggrecan의 발 현이 유의적으로 증가하는 것을 확인하였다. 이는 물리적 인자인 전기 자극으로 줄기세포의 연골세포 분화가 가능 함을 의미한다.

Acknowledgements

본 연구는 농림축산검역본부 연구사업(과제번호: M- 1543083-2019-21-0101)의 지원으로 수행되었으며, 이에 감사드립니다.

REFERENCES

1. Weissma, I. L. (2000) Translating stem and progenitor cell biol- ogy to the clinic: barriers and opportunities. Science. 287: 1442- 1446.

2. Ding, D. C., W. C. Shyu, and S. Z. Lin (2011) Mesenchymal stem cells. Cell Transplant. 20: 5-14.

3. Mihevc, S. P., V. K. Grgich, A. N. Kopitar, L. Mohorič, and G.

Majdič (2020) Neural differentiation of canine mesenchymal stem cells/multipotent mesenchymal stromal cells. BMC Vet Res. 16:

282.

4. Gazit, Z., G. Pelled, D. Sheyn, N. Kimelman, and D. Gazit (2011) Mesenchymal stem cells. 3rd ed., pp. 285-304. Principles of regen- erative medicine, USA.

5. Zuk, P. A., M. Zhu, H. Mizuno, J. Huang, J. W. Futrell, A. J. Katz, P. Benhaim, H. P. Lorenz, and M. H. Hedrick (2001) Multilineage cells from human adipose tissue: implications for cell-based thera- pies. Tissue Eng. 7: 211-228.

6. Gronthos, S., D. M. Franklin, H. A. Leddy, P. G. Robey, R. W.

Storms, and J. M. Gimble (2001) Surface protein characterization of human adipose tissue-derived stromal cells. J Cell Physiol. 189:

54-63.

7. Hauner, H., P. Schmid, and E. F. Pfeiffer (1987) Glucocorticoids and insulin promote the differentiation of human adipocyte precur- sor cells into fat cells. J Clin Endocrinol Metab. 64: 832-835.

8. Centers for Disease Control and Prevention. Data & Stats by Topic. https://www.cdc.gov.

9. Health Insurance Review & Assessment Service. https://open- data.hira.or.kr/home.do.

10. Krishnan, Y., and A. J. Grodzinsky (2018) Cartilage diseases.

Matrix Biol. 71-72: 51-69.

11. Fox, A. J. S., A. Bedi, and S. A. Rodeo (2009) The basic science of articular cartilage: Structure, composition, and function. Sports Health. 1: 461-468.

12. Buckwalter, J. A., and H. J. Mankin (1998) Articular cartilage: tis- sue design and chondrocyte-matrix interactions. Instr Course Lect.

47: 477-486.

13. Van Mow, C., and X. E. Guo (2002) Mechano-electrochemical properties of articular cartilage: their inhomogeneities and anisot- ropies. Annu Rev Biomed Eng. 4: 175-209.

14. Petters, O., C. Schmidt, C. Thuemmler, F. Peinemann, M. Zschar- nack, J. S. Somerson, and R. M. Schulz (2018) Point-of-care treat- ment of focal cartilage defects with selected chondrogenic mesenchymal stromal cells-An in vitro proof-of-concept study. J Tissue Eng Regen Med. 12: 1717-1727.

15. Filardo, G., H. Madry, M. Jelic, A. Roffi, M. Cucchiarini, and E.

Kon (2013) Mesenchymal stem cells for the treatment of cartilage lesions: from preclinical findings to clinical application in ortho- paedics. Knee Surg Sports Traumatol Arthrosc. 21: 1717-1729.

16. Kuçi, Z., S. Kuçi, S. Zircher, S. Koller, R. Schubert, H. Bönig, R.

Henschler, R. Lieberz, T. Klingebiel, and P. Bader (2011) Mesen- chymal stromal cells derived from CD271

+

bone marrow mononu- clear cells exert potent allosuppressive properties. Cytotherapy. 13:

1193-1204.

17. Jezierska-Wozniak, K., M. Barczewska, A. Habich, P. Wojtacha, W. Badowska, W. Maksymowicz, and J. Wojtkiewicz (2017) The feasibility of the CD271

+

and CD271

-

mesenchymal stromal cell enrichment toward nucleus pulposus-like cells. Folia Histochem Cytobiol. 55: 114-123.

18. Busser, H., M. Najar, G. Raicevic, K. Poeters, R. Velez Pombo, P.

Philippart, N. Meuleman, D. Bron, and L. Lagneaux (2015) Isola- tion and characterization of human mesenchymal stromal cell sub- populations: comparison of bone marrow and adipose tissue. Stem Cells Dev. 24: 2142-2157.

19. Kohli, N., I. R. T. Al-Delifi, M. Snow, T. Sakamoto, T. Miyazaki, H. Nakajima, K. Uchida, and W. E. B. Johnson (2019) CD271- selected mesenchymal stem cells from adipose tissue enhance car- tilage repair and are less angiogenic than plastic adherent mesen- chymal stem cells. Sci Rep. 9: 3194.

20. Calabrese, G., R. Giuffrida, D. Lo Furno, N. L. Parrinello, S. Forte, R. Gulino, C. Colarossi, L. R. Schinocca, R. Giuffrida, V. Cardile, and L. Memeo (2015) Potential effect of CD271 on human mesen- chymal stromal cell proliferation and differentiation. Int J Mol Sci.

16: 15609-15624.

21. Mow, V. C., C. C. Wang, and C. T Hung (1999) The extracellular matrix, interstitial fluid and ions as a mechanical signal transducer in articular cartilage. Osteoarthr Cartil. 7: 41-58.

22. Wan, L. Q., C. Miller, X. E. Guo, and V. C. Mow (2004) Fixed electrical charges and mobile ions affect the measurable mechano- electrochemical properties of charged-hydrated biological tissues:

the articular cartilage paradigm. Mech Chem Biosyst. 1: 81-99.

23. Xu, J., W. Wang, C. C. Clark, and C. T. Brighton (2009) Signal transduction in electrically stimulated articular chondrocytes involves translocation of extracellular calcium through voltage- gated channels. Osteoarthr Cartil. 17: 397-405.

24. Lu, X. L., L. Q. Wan, X. E. Guo, and C. A. van Mow (2010) A lin- earized formulation of triphasic mixture theory for articular carti- lage, and its application to indentation analysis. J Biomech. 43:

673-679.

25. Hernández-Bule, M. L., C. L. Paíno, M. Á. Trillo, and A. Úbeda

(2014) Electric stimulation at 448 kHz promotes proliferation of

human mesenchymal stem cells. Cell Physiol Biochem. 34: 1741-

(8)

1755.

26. Grodzinsky, A. J., H. Lipshitz., and M. J Glimcher (1978) Electro- mechanical properties of articular cartilage during compression and stress relaxation. Nature. 275: 448-450.

27. Schmidt-Rohlfing, B., U. Schneider., H. Goost, and J. Silny (2002) Mechanically induced electrical potentials of articular cartilage. J Biomech. 35: 475-482.

28. Bassett, C. A., and R. J. Pawluk (1972) Electrical behavior of carti- lage during loading. Science. 178: 982-983.

29. Wang, W., Z. Wang, G. Zhang, C. C. Clark, and C. T. Brighton (2004) Up-regulation of chondrocyte matrix genes and products by electric fields. Clin Orthop Relat Res. 427: S163-S173.

30. Brighton, C. T., W. Wang, and C. C. Clark (2006) Up-regulation of matrix in bovine articular cartilage explant by electric fields. Bio- chem Biophys Res Commun. 342: 556-561.

31. Beckenkamp, L. R., L. E. B. Souza, F. U. F. Melo, C. H. Thome, D. A. R. Magalhaes, P. V. B. Palma, and D. T. Covas (2017) Com- parative characterization of CD271

+

and CD271

-

subpopulations of CD34

+

human adipose-derived stromal cells. J Cell Biochem.

119: 3873-3884.

32. Mifune, Y., T. Matsumoto., S. Murasawa, A. Kawamoto, R.

Kuroda, T. Shoji, T. Kuroda, T. Fukui, Y. Kawakami, K. Kuro- saka, and T. Asahara (2013) Therapeutic superiority for cartilage repair by CD271-positive marrow stromal cell transplantation. Cell Transplant. 22: 1201-1211.

33. Lauing, K., L. M. Cortes, M. S. Domowicz, J. G. Henry, A. T.

Baria, and N. B. Schwartz (2014) Aggrecan in required for growth plate cytoarchitecture and differentiation. Dev Biol. 396: 224-236.

34. Nejadink, H., S. Diecke, O. D. Lenkov, F. Chapelin, J. Donig, X.

Tong, N. Derugin, R. C. Chan, A. Gaur, F. Yang, J. C. Wu, and H.

E. Daldrup-Link (2015) Improved approach for chondrogenic dif- ferentiation of human induced pluripotent stem cells. Stem Cell

Rev Rep. 11: 242-253.

35. Boileau, C., J. Martel-Pelletier, J. Brunet, D. Schirer, C. Flory, M.

Boily, and J. P. Pelletier (2006) PD-0200347, an α

2

δ ligand of the voltage gated calcium channel, inhibits in vivo activation of the Erk1/2 pathway in osteoarthritic chondrocytes: a PKC

α

dependent effect. Ann Rheum Dis. 65: 573-580.

36. Otsuka, G., T. Kubo, J. Imanishi, and Y. Hirasawa (1996) Expres- sion of heat-shock-proteins in the differentiation process of chon- drocytes. Nihon Geka Hokan. 65: 39-48.

37. Son, Y. O., H. E. Kim., W. S. Choi., C. H. Chun, and J. S. Chun (2019) RNA-binding protein ZFP36L1 regulates osteoarthritis by modulating members of the heat shock protein 70 family. Nat Commun. 10: 77.

38. Tsuchida, S., Y. Arai, K. A. Takahashi, T. Kishida, R. Terauchi, K.

Honjo, S. Nakagawa, H. Inoue, K. Ueshima, T. Matsuki, O.

Mazda, and T. Kubo (2014) HIF-1 α -induced HSP70 regulates anabolic responses in articular chondrocytes under hypoxic condi- tions. J Orthop Res. 32: 975-980.

39. Li, D., K. Sunderic, S. B. Nicoll, and S. Wang (2018) Downregula- tion of heat shock protein 70 impairs osteogenic and chondrogenic differentiation in human mesenchymal stem cells. Sci Rep. 8: 553.

40. Kwon, H. J., G. S. Lee, and H. Chun (2016) Electrical stimulation drives chondrogenesis of mesenchymal stem cells in the absence of exogenous growth factors. Sci Rep. 6: 39302.

41. Vaca-González, J. J., J. M. Guevara, M. A. Moncayo, H. Castro- Abril, Y. Hata, and D. A. Garzon-Alvarado (2019) Biophysical stimuli: a review of electrical and mechanical stimulation in hya- line cartilage. Cartilage. 10: 157-172.

42. Mow, V. C., A. Ratcliffe, and A. R. Poole (1992) Cartilage and

diarthrodial joints as paradigms for hierarchical materials and

structures. Biomaterials. 13: 67-97.

참조

관련 문서

This study was conducted to confirm the panel of human antibodies applicable for use in immunophenotypic characterization of canine adipose-derived stem cells and

Mesenchymal stem cells (MSCs) secrete a variety of neu- roregulatory molecules, such as nerve growth factor, brain-derived neurotrophic factor, and glial cell-derived

Several distinct cell types are sources for cardiac regeneration therapy, including human mesenchymal stem cells (hMSCs), 7) adipose tissue-derived stem cells, 8) umbilical

Comparative analysis of human mesenchymal stem cells from bone marrow, adipose tissue, and umbilical cord blood as sources of cell therapy.. Fetal mesenchymal stem

Conditioned media from human adipose tissue-derived mesenchymal stem cells and umbilical cord-derived mesenchymal stem cells efficiently induced the apoptosis and

The expression of muscle-related proteins in the tonsil-derived mesenchymal stem cells (T-MSCs) during the process of myogenic induction (T-MSCs; T-MSC-derived myoblasts;

BMAC, bone marrow aspirate concentrate; MSC, mesenchymal stem cell; BM, bone marrow-derived; AD, adipose tissue-derived; S, synovium-derived; hUCB, human umbilical

mRNA expression of nestin, β -tubulin III, and GFAP before and after human muscle-derived stem cells (hMDSCs) and human-adipose tissue derived stem cells (hADSCs)