C. Haplotype analysis of ALOX5
V. CONCLUSION
Our study suggest a lack of association between ALOX5AP, PTGS2, LTC4S, and CYSLTR1 gene polymorphisms, and AIA phenotype in Korean population. However, a possible involvement of ALOX5-ht1[G-C-G-A] in AIA development was suggested.
Table 1. Amplifying and extension primers of the candidate genes
Gene Locus Position Primers
ALOX5 -1708G>A Promoter For/Rev AAAGAACAGCGTTGGTGGAT/CAAATTCATTGTGTTGCATGTG
Extension TAATGATTATATAATCATGATTATAATCAATGATGATCCTGAAGTACATCACGCTGAAGAC
21C>T Exon1 For/Rev CGCCATGCCCTCCTACAC/CCACGCTCGAAGTCGTTGTA
Extension ATGATTATATAATCATGATTATAATCAATGATGATCACGCCCTTGGCAGTCGG
270G>A Exon2 For/Rev TGTGGACGAGGAACTGGGC/CTCACCGCGTCCATCCCT
Extension AATGATTATATAATCATGATTATAATCAATGATGATCACTGCTTGATTACCGCAGTG
1728A>G Exon13 For/Rev GTGCTCCTGGATCCCCAAT/CTCGTTTTCCTGGAACTGGC
Extension ATGATTATATAATCATGATTATAATCAATGATGATGCACTGTATAGCATTGTACATTACAGATCA
ALOX5A P 218A>G 3' For/Rev CGGGAACAAAATGATGTCA /AAACACAAACCTGGTCACAAA
Extension TCATGATTATAATCAATGATGATGCCCCAAATTTGCTATTCCC
PTGS2 -162C>G Promoter For/Rev GAAGAAAAGACATCTGGCGGA/GGCTGTGGAGCTGAAGGAG
Extension TGATGCAGGGTTTTTTACCCACG
10T>G 5'UTR For/Rev GAAGAAAAGACATCTGGCGGA/GGCTGTGGAGCTGAAGGAG
Extension AATCAATGATGATTGACGCTCACTGCAAGTCGT
R228H* Exon6 For/Rev ATATAAGAAAAACTTCAACAGCAA/AACACATTTTTAGGGATTTTAAA
(G>A) Extension TATAATCAATGATGATGGTGAAACTCTGGCTAGACAGC
V511A† Exon10 For/Rev GAGCTGTATCCTGCCCTTCTG /CCACTTCTCCACCAAAAGTGC
(T>C) Extension ATGATGATTCAAGGAGAATGGTGCTCCA
LTC4S -444A>C Promoter For/Rev CATTCTGAAGCCAAAGGCACT/TGCACCACCCCACTTTCTC
Extension AACAGCCTGGATGGGGAC
CYSLTR1 927T>C Exon1 For/Rev AAATCATGTTTTGGTCTTGC/ATTTTCATTGGTTTGGACTG
Extension GGGGTAACTTTAGGAAAAGGCTGTCTACATT
For/Rev: Forward and reverse amplifying primers
*R: arginine, H: histidine. †V: valine, A: alanine
Table 2. Clinical characteristics of the study subjects
AIA (N=93) ATA (N=181) NC(N=123)
Age(year)* 42.3 ± 14.2 44.4 ± 13.9 35.4 ± 14.5
Sex(M)* 35(37.6%) 55(30.4%) 63(51.2%)
Atopy* 34(36.6%) 44(24.3%) 19(15.4%)
Asthma duration(year) 7.0 ± 6.2 7.2 ± 9.3 NA
FEV1(%) 82.1 ± 21.8 81.3 ± 21.1 98.7 ± 13.0
PC20, methacholine (mg/ml) 5.5 ± 11.2 6.1 ± 10.1 NA
Serum total IgE (IU/ml) 352.8 ± 451.5 420.7 ± 686.2 70.0 ± 71.1 Peripheral eosinophil count (/ul) 380.5 ± 355.0 491.2 ± 881.3 143.8 ± 95.8
Rhinitis† 64(68.8%) 76(42.0%) NA
Paranasal sinusitis 40/59(67.8%) NA NA
Nasal polyp 27/40(67.5%) NA NA
Urticaria/angioedema 21/64(32.8%) NA NA
AIA: ASA-intolerant asthma; ATA: ASA-tolerant asthma; NC: normal controls; N: number of patients.;
NA =not applicable.
*p<0.01 AIA vs. NC, ATA vs. NC, †p<0.01 AIA vs ATA
Table 3. The allele and genotype frequencies of the SNPs in the candidate genes
AIA: ASA-intolerant asthma; ATA: ASA-tolerant asthma; NC: normal controls; N: number of patients.
†Each p values were calculated with co-dominant, dominant, and recessive models. Logistic regression analysis was applied controlling for age, sex and atopy as covariables.
Table 3. The allele and genotype frequencies of the SNPs in the candidate genes, continued.
AIA: ASA-intolerant asthma; ATA: ASA-tolerant asthma; NC: normal controls; N: number of patients.
* R:arginine, H:histidine.
†Each p values were calculated with co-dominant, dominant, and recessive models. Logistic regression analysis was applied controlling for age, sex and atopy as covariables.
Table 4. Haplotype frequencies of ALOX5 gene
Haplotypes with frequency more than 1% were listed.
Haplotype of ALOX5 was in order of –1708G>A →21C>T→270G>A→1728A>G.
Rase alleles were expressed as bold.
AIA: ASA-intolerant asthma; ATA: ASA-tolerant asthma; NC: normal controls; ht:
haplotype; n=number of chromosome.
*Logistic regression analysis was applied controlling for age, sex and atopy as covariables.
Table 5. Genotype distributions of haplotype of ALOX5
* Each p values were calculated with co-dominant, dominant, and recessive models. Logistic regression analysis was applied controlling for age, sex and atopy as covariables . Haplotypes 2, 3 and 5 are equivalent with ALOX5-1708G>A, ALOX5+270G>A and ALOX5+1728A>G, respectively.
BIBLIOGRAPHY
1. Samter M, Beers RF : Concerning the nature of intolerance to aspirin. J Allergy 40:281-93, 1967
2. Szczeklik A, Stevenson DD: Aspirin- induced asthma: advances in pathogenesis, diagnosis, and management. J Allergy Clin Immunol 111:913-21,2003
3. Szczeklik A, Gryglewski RJ, Czerniawska-Mysik G: Relationship of inhibition of prostaglandin biosynthesis by analgesics to asthma attacks in aspirin-sensitive patients. Br Med J 1:67-9,1975
4. Szczeklik A: The cyclooxygenase theory of aspirin- induced asthma. Eur Respir J 3:588-93, 1990
5. Picado C: Aspirin- intolerant asthma : role of cyclo-oxygenase enzymes. Allergy 72 (suppl):58-60, 2002
6. Lewis RA, Austen KF, Soberman RJ: Leukotrienes and other products of the 5-lipoxygenase pathway. N Engl J Med 323:645-5, 1990
7. Henderson WR Jr: The role of leukotrienes in inflammation. Ann Intern Med 121:684-97, 1994
8. Foegh ML, Hecker M, Ramwell PW: The eicosanoids: prostaglandins, thromboxanes, leukotrienes, & related compounds. In Basic & clinical pharmacology (ed. Katzung BG) Connecticut, Appleton & Lange, 1998, pp 304-18
9. Hui Y, Funk CD: Cysteinyl leukotriene receptors. Biochem Pharmacol 64:1549-57, 2002
10. Cowburn AS, Sladek K, Soja J, Adamek L, Nizankowska E, Szczeklik A, et al:
Overexpression of leukotriene C4 synthase in bronchial biopsies from patients with aspirin- intolerant asthma. J Clin Invest 101:834-46, 1998
11. Sanak M, Simon HU, Szczeklik A: Leukotriene C4 synthase promoter polymorphism and risk of aspirin- induced asthma. Lancet 350:1599-600, 1997 12. Sanak M, Pierzchalska M, Bazan-Socha S, Szczeklik A: Enhanced expression of
the leukotriene C4 synthase due to overactive transcription of an allelic variant associated with aspirin- intolerant asthma. Am J Respir Cell Mol Biol 23:290-6, 2000
13. Van Sambeek R, Stevenson DD, Baldasaro M, Lam BK, Zhao J, Yoshida S, et al:
5’ flanking region polymophism of the gene encoding leukotriene C4 synthase does not correlate with the aspirin- intolerant asthma phenotype in the United States. J Allergy Clin Immonol 106:72-6, 2000
14. Kawagishi Y, Mita H, Taniguchi M, Maruyama M, Oosaki R, Higashi N, et al:
Leukotriene C4 synthase promoter polymophism in Japanese patients with aspirin- induced asthma. J Allergy Clin Immunol 109;936-42, 2003
15. In KH, Asano K, Beier D, Grobholz J, Finn PW, Silverman EK, et al: Naturally occurring mutations in the human 5- lipoxygenase gene promoter that modify
transcription factor binding and reporter gene transcription. J Clin Invest 99:1130-7, 1997
16. Chai H, Farr RS, Froehlich LA, Mathison DA, McLean JA, Rosenthal RR, et al:
Standardization of bronchial inhalation challenge procedures. J Allergy Clin Immunol 56:323-7, 1975
17. Park HS: Early and late onset asthmatic responses following lysine-aspirin inhalation in aspirin-sensitive asthmatic patients. Clin Exp Allergy 25:38-40, 1995
18. Schunck B, Kraft W, Truyen U: A simple touch-down polymerase chain reaction for the detection of canine parvovirus and feline panleukopenia virus in feces. J Virol Methods 55:427-33, 1995
19. Niu T, Qin ZS, Xu X, Liu JS: Bayesian haplotype inference for mutiple linked single- nucleotide polymorphisms. Am J Hum Genet 70:157-69, 2002
20. Hedrick PW: Gametic disequilibrium measures: proceed with caution. Genetics 117:331-41, 1987
21. Liu MC, Dube LM, Lancaster J: Acute and chronic effects of a 5- lipoxygenase inhibitor in asthma: a 6- month randomized multicenter trial. J Allergy Clin Immunol 98:859-71, 1996
22. Kwok PY, Gu Z: Single nucleotide polymorphism libraries: why and how are we building them? Mol Med Today 5:538-43, 1999
23. Kennedy BP, Diehl RE, Boie Y, Adam M, Dixon RAF: Gene characterization and promoter ana lysis of the human 5- lipoxygenase-activating protein (FLAP). J Biol Chem 266:8511-6, 1991
24. Koshino T, Takano S, Houjo T, Sano Y, Kudo K, Kihara H, et al: Expression of 5-lipoxygenase and 5- 5-lipoxygenase activation protein mRNAs in the peripheral blood leukocytes of asthmatics. Biochem Biophys Res Commun 247:510-3, 1998
25. Koshino T, Takano S, Kitani S, Ohshima N, Sano Y, Takaishi T, et al: Novel polymorphism of the 5- lipoxygenase activating protein(FLAP) promoter gene associated with asthma. Moll Cell Biol Res Commun 2:32-5, 1999
26. Gilroy DW, Colville-Nash PR, Willis D, Chivers J, Paul-Clark MJ, Willoughby DA: Inducible cyclooxygenase may have anti- inflammatory properties. Nat Med 5:698-701, 1999
27. Picado C, Fernàndez-Morata JC, Juan M, Roca-Ferrer J, Fuentes M, Xaubet A, et al: Cyclooxygenase-2 mRNA is downexpressed in nasal polyps from aspirin-sensitive asthmatics. Am J Respir Crit Care Med 160:291-6, 1999
28. Fritsche E, Baek SJ, King LM, Zeldin DC, Eling TE, Bell DA: Functional characterization of cyclooxygenase-2 polymorphisms. J Pharmacol Exp Ther 299:468-76, 2001
29. Drazen JM, Israel E, O’byrne PM: Treatment of asthma with drugs modifying the
leukotriene pathway. N Engl J Med 340:197-206, 1999
30. Sousa AR, Parikh A, Scadding G, Corrigan CJ, Lee TH: Leukotriene receptor expression on nasal mucosal inflammatory cells in aspirin-sensitive rhinosinusitis. N Engl J Med 347:1493-9, 2002
31. Brookes AJ: The essence of SNPs. Gene 234:177-86, 1999
- 국문요약 -
아 스 피 린 과 민 성 천 식 에 서 류 코 트 리 엔 의 생 합 성 에 관 여 하 는 효 소 들 과 그 수 용 체 의 단 일 염 기 다 형
아주대학교 대학원 의학과 최 정 희
(지도교수: 박 해 심)
목적: 아스피린 과민성 천식은 성인 천식 환자의 5-10% 정도로 아스피린 과민성과 기관지천식, 비용종 및 비염을 특징으로하는 임상 증후군이다. 최근 폴란드와 일본에서 5-lipoxygenase (ALOX5) pathway 의 leukotriene C4 synthase (LTC4S) 유전자의 -444A>C 단일염기다형(single nucleotide polymorphism, SNP)이 아스피린 과민성 천식에서 유의하게 증가하여 병인기전에 관여할 것으로 보고하였으나 미국 백인을 대상으로 한 보고에서는 유의한 차이가 없었다. 이에 저자들은 아스피린 과민성 천식의 병인기전에 관여할 것으로 예측되는 효소와 수용체의 SNP 들을 검색하여 한국인 고유의 아스피린 과민성 천식 환자들의 SNP 을 분석하고자 하였다.
대상 및 방법: 아스피린 과민성 천식 93 명과 아스피린 내성 천식 181 명, 정상대조군 123 명을 대상으로 하였다. 아스피린 과민성 천식은 lysine-aspirin 기도유발시험으로 진단하였다. ALOX5 (-1708G>A, 21C>T, 270G>A, 1728G>A), ALOX5 activating protein (ALOX5AP, 218A>G), prostaglandin-endoperoxide synthase 2 (PTGS2, COX2 -162C>G, 10T>G, R228H, V511A), LTC4S (-444A>C), cysteinyl leukotriene receptor 1 (CYSLTR1, 927T>C)의 SNP 들을 SNaPSHOT 법으로 분석하였고, ALOX5 의 일배체형 분석도 시행하였다.
결과: 각각의 SNP 들에서 아스피린 과민성 천식, 아스피린 내성 천식 및 정상대조군 세군간에 대립유전자 빈도, 유전자형 빈도는 유의한 차이가 없었다 (p>0.05). 그러나, ALOX5 일배체형의 두배수체 분석에서 ALOX5-ht1[G-C-G-A]의 빈도는 아스피린 과민성 천식(92.4%)에서 아스피린 내성 천식(82.3%, p=0.01, OR=5.0, 95%CI=1.54-17.9) 및 정상대조군(90.0%, p=0.03, OR=4.5, 95%CI=1.1-18.4)에서 보다 dominant model 로 분석하였을 때 유의하게 높았다
결론: 한국인에서 ALOX5AP, PTGS2, LTC4S, CYSLTR1 의 단일염기다형은 아스피린 과민성 천식과 연관성이 없었으나, ALOX5-ht1[G-C-G-A]는 유의한 연관성을 보였다. 추후 본 연구에서의 SNP 들과 밀접하게 연관된 새로운 SNP 을 더 연구할 필요가 있으며, 특히 유의한 연관성을 보인 ALOX5 일배체형의 경우 기능적인 연구가 필요하다.
핵 심 되 는 말: 아스피린 과민성 천식, 단일염기다형, ALOX5, ALOX5AP, PTGS2, LTC4S, CYSLTR1, 일배체형