이상수∙허재영∙우창훈*∙김재홍*∙장준동**

317

목 적 :티타늄 입자에 의한c-fos 유전자 발현에 관련된 세포내 신호전달을 이해하기 위해, Rac, cytosolic phospholipase A2, eicosanoids (e.g., leukotriene B4 and prostaglandin E2) 그리고, c-fos의 관련에 대해 분석 하였다.

대상 및 방법 : Rat-2 섬유 아세포에 티타늄 입자를 첨가 하여c-fos serum response element의 활성도 변화를 조사 하였다.

c-fos serum response element의 측정을 위해 luciferase reporter system을 이용하였으며, luciferase는 scintillation spec- trophotometer로 활성도를 측정하였다. 다음, c-fos로의 활성화 경로 내에서 Rac의 연관성과 그 하류 전달체로서의 eicosanoids 합성 역할을 분석하였다.

결 과 :티타늄 입자에 의해c-fos serum response element의 활성화가 일어나는 것이 확인되었으며, 또한 RacN17, cytoso- lic phospholipase A2, cyclooxygenase, 5-lipoxygenase의 억제제 투여에 의해 선택적으로 억제 되었다. 또한, eicosanoids의 합성이 Rac 의존성 방식으로 티타늄 마모편에 의해 증가 하였다.

결 론 :티타늄에 의한 신호 전달계에서는 G-단백의 일종인 Rac과 eicosanoids 합성이 필수적인 역할을 하고 있다. 또한 이러한 Rac-cytosolic phospholipase A2-eicosanoids-c-fos 신호전달계가 인공 삽입물 주위의 골 용해에서, 티타늄 입자에 의한 eicosanoids합성을 일으키는 기작으로 관여할 가능성을 생각할 수 있다.

색인 단어 : 섬유 아세포, 티타늄, Rac, Eicosanoid, c-fos

317

티타늄 입자에 의한 G-단백 Rac과 Eicosanoids의 활성화 경로

이상수∙허재영∙우창훈*∙김재홍*∙장준동**

포항성모병원 정형외과, 고려대학교 생명공학원*, 한림의대 정형외과학교실**

서 론

세포는 외부 환경의 변화나 자극에 대하여, 신호 전이(signal transduction)라는 세포 내 기작을 통해 빠르게 반응한다²¹⁾. 세 포자극물질(agonist)은 세포를 통과하지 못하기 때문에 세포막 에 존재하는 수용체와 결합한 후 세포내부에 있는 신호전달체계 를 활성화 시키기 위한 이차신호전달물질(second messenger) 을 생성한다. 이차신호전달물질에는 Ca2+, cyclic AMP, cyclic GMP, inositol, 1,4,5-triphosphate (IP3), diacylglyc- erol, phosphatidic acid 등 다양한 종류가 알려져 있다. 최근에 는 nitric oxide (NO)나 reactive oxygen species (ROS) 등 의 활성물질도 세포의 신호전달에 중요하게 작용하는 것으로 알 려지고 있다^21,28). 인공 관절 소재로부터 형성되는 마모편 입자 들도 역시 삽입물 주위의 여러 가지 종류의 세포들을 자극하게 된다. 여기에는 섬유 아세포, 파골 세포, 골 모세포, 대식 세포 들이 포함된다^21,24,26). 특히 삽입물 주위의 섬유 아세포에서는 정 상의 활막 조직이나 피부의 섬유 아세포 보다 metalloproteinase 들의 농도가 증가 되어 있다³⁰⁾.

c-fos는 최조기 유전자(immediate early gene)의 일종이며, 성장인자, cytokine, 환경적 스트레스 같은 여러 가지 세포외적 신호에 의해 즉각적으로 발현이 된다. c-fos 유전자의 지속적 발현은 특정 세포에 제한되어 있지만, 거의 모든 세포에서 다양 한 자극에 대하여 일시적으로 발현이 될 수가 있다. 특히, c-fos 는 세포의 분할과 분화 조절의 중요한 기능을 한다고 할 수 있 다. c-fos에 존재하는 Serum Response Element (SRE)는 세 포외적 자극의 일차적 핵 표적(nuclear target)으로 알려져 있 으며, c-fos 유전자 전사의 급속유도에 관여하는 것으로 알려져

있다^18,20,25). 본 연구에서는 섬유 아세포에서 인공 관절 소재인

티타늄 입자를 자극물질로 하여, G-단백 중 Rho family GTPase의 일종인 Rac과 cytosolic phospholipase A²(cPLA²), eicosanoids, 그리고 c-fos SRE를 중심으로 한 신호 전달계를 분석 하였다.

재료 및 방법

본 연구의 개요는 아래와 같다. 첫째, 티타늄이c-fos SRE를 활성화시키는 여부를 확인하였다. 이를 위해, Rat-2 섬유 아세 포를 luciferase 부호 서열이 결합된c-fos minimal promoter의 상부에 c-fos SRE oligonucleotides가 삽입된 지시 plasmid인 pSRE-Luc (3 g)와 과도이입 하였다¹⁴⁾(Fig. 2A). 티타늄 입

317 317 통신저자 : 장 준 동

서울특별시 영등포구 영등포동 94-200

한림대학교 의과대학 부속 한강성심병원 정형외과 TEL: 02-2639-5301∙FAX: 02-2631-9337

E-mail: [email protected]

자 처리 전, 이입된 Rat-2 세포를 36시간동안 0.5% 우태아혈청 을 포함한 Dulbecco’s modified eagle’s medium (DMEM)에 서 배양하여 혈청 기아(serum starvation)처리 하였다. c-fos SRE 활성도는 luciferase 활성도를 측정하여 분석 하였다.

둘째, c-fos SRE 활성화를 위한 신호계는, Elk-1p62^TCF의존 성 신호 경로 뿐만 아니라, 비의존성 신호 경로계가 존재 한다

2,4,12,27). 따라서 Elk-1p62^TCF가 결손된 변이형 oligonucleotide

(AGG to TGT)를 포함하는 pSREmt-Luc을 사용하여 티타 늄 입자로 유발되는c-fos SRE 활성화에는 어떠한 신호 전달 계가 작용하는지 분석하였다¹⁴⁾. 또한 MEK 억제제와 MEK1- dominant negative (DN) mutant를 사용하여 Ras-mitogen activated protein (MAP) kinase 경로의 관련을 확인하였다.

셋째, 티타늄 입자의 c-fos SRE로의 신호계에서 G-단백중 Rho family의 small GTPase인 Rac이 관여할 가능성에 대해 분석하였다. 이를 위하여 pSRE-Luc (3 g)을 대조군인 pEXV와 Rac1의 우성결손변이형으로 부호화한 pEXV- RacN17으로 공동이입 하였다. 또한 Rat-2와 Rat2-RacN17에 서 SRE-luciferase 활성도를 비교하여 다시 분석 하였다.

넷째, 일반적으로, Rac-c-fos SRE의 신호 전달계에서 cPLA²가 Rac의 중요한 하류 전달체로서 기여한다고 알려져 있

다^15,16). 그러므로, 티타늄-c-fos SRE 신호계에서 cPLA²가 하

류전달체로 관여할 가능성을 생각할 수 있다. 이를 규명하기 위 해서 cPLA², 5-lipoxygenase (5-Lo), cycloxygenase (COX) 에 대한 억제제들을 함께 투여하여 분석하였다.

다섯째, eicosanoids의 합성이 유발되는 기전을 규명하기 위

해, 티타늄 입자에 의한 leukotriene B⁴ (LTB⁴)와 prosta- glandin E² (PGE²)의 세포내 변화를 측정하였다. 또한 합성 유 발 경로가 Rac-cPLA²에 의존하는지 알기 위해 Rat-2와 Rat2- RacN17에서c-fos SRE-luciferase 활성도를 비교하였다.

1. Chemicals and Plasmids

Commercially pure Titanium 입자(#000681, 280 mg/0.2 mL, 1-3 m; Alpha chemicals, USA)를 사용하여 멸균된 phosphate buffered saline (PBS; pH7.2)에 저장 하였다. 우 태아혈청(fetal bovine serum)과 DMEM은 Gibco-BRL사의 제품을, Indomethacine, MAFP, MK886, Aspirin, NS-398, PD098059, Wortmannin은 Sigma chemical사와 Calbiochem.

사의 제품을 사용 하였다. 다른 모든 시약들도 분자 생물학적 등급내지는 그 이상의 표준화된 것을 사용하였다. pSRE-Luc은 pFos-lcf에서 분리하여, -53에서 +45의 서열을 포함하는c-fos 촉진자(promoter)의 -53 위치에 삽입하였다(Fig. 2A). c-fos 촉진 유전자에는 luciferase 유전자가 함께 결합되었다¹⁴⁾. 야생 형(pSREwt-Luc)과 변이형(pSREmt-Luc) SRE oligonu- cleotide의 염기 서열은 각각, AGGATGTCCATATTAG- GACATCT와 tGtATTCCATATTAGGACATCT이다.

PEXV, pEXV-RacN17 plasmids는 Dr. A. Hall (London, UK)이 제공하였다. 각 실험들은 모두 두 개의 독립된 격리 세 트에서 각 3회 시행하였고, 결과들의 평균 값을 구하였다.

Relative Luciferase Activity

2

1

0

0 0.05 0.075 0.1 0.25 0.5

Relative Luciferase Activity

2

1

0

0 1 1.5 2 2.5 3 4

Fig. 1.Titanium-particles activate c-fos SRE in a dose and time-dependent manner. After transient transfections with wild-type pSREwt- Luc (3 g) plasmids, Rat-2 cells were serum starved in DMEM/0.5% FBS for 36 h before adding Titanium-particles. (A) Dose-dependent response of Titanium-particles on c-fos SRE activation. Serum starved cells were treated with various amounts of Titanium-particles (0.0, 0.05, 0.075, 0.1, 0.25, 0.5 mg/mL) for 3 h. (B) Time-dependent response of Titanium-particles (0.1 mg/mL) on c-fos SRE activation.

Serum-starved Rat-2 cells were treated with Titanium-particles for the lengths of time indicated. Luciferase activities were measured and normalized to the co-transfected -galactosidase activities. Values are representative of triple transfections.

HOURS

Titanium-particle (mg/mL) A B

2.

, DNA

Luciferase

Rat-2 섬유 아세포주는 American Type Culture Collection (CRL 1764)에서 입수 하였다. 세포는 non-essential amino acids 0.1 mM (Gibco-BRL, Gaithersburg, MD, USA)과 10%의 우태아혈청, 50 units/mL의 penicillin, 50 g/mL의 streptomycin을 포함한 DMEM에서 5% 이산화탄소, 95% 공 기의 비율(v/v)과 37℃ 온도 조건으로 배양하였다. Rat2- RacN17 안정세포주는 Rac1의 우성결손변이형(dominant neg- ative mutant)인 RacN17의 발현형을 가지며, pSV-Neo^� plasmid를 pEXV-myc-RacN17 plasmid와 공동이입(co- transfection)한 후 2-3주간 G418 항생제(400 g/mL)를 투여 하여 분리 하였다. RacN17 단백의 발현은 anti-myc 항원결정

기(epitope)항체를 이용한 Western blot hybridization으로 확 인하였다. 과도이입(transient transfection)은 100 mL 배양접 시 당 5×105개의 세포를 분주한 후 인산화 칼슘(calcium phosphate)을 첨가하여 24시간 동안 이루어졌다. DNA 침전물 은 배양접시 당 20 g의 DNA를 사용하여 만들어 졌으며, 사 용된 plasmid의 양은 reporter gene (e.g. pSRE-Luc)은 3 g 이며 small GTPase 발현형 plasmid (e.g. pEXV-RacV12)는 5 g이다.

유전자 이입시의 오차를 보정하기 위해, 모든 clone은 1 g의 pCMV- GAL을 이입 하였다. pCMV- GAL은 E.coli - galactosidase (lac Z) structural gene이 CMV 촉진자(pro- moter)의 전사 제어 조절하에 있는 진핵 발현 벡터(eukaryotic expression vector)이다. 인산화 칼슘으로 DNA 침전물 세포를 PBS로 2회 세척한 후 0.5% 우태아혈청을 포함하는 신선 DMEM에서 36시간 동안 배양하였다. 각 배양접시의 세포를 우 태아혈청으로 2회 세척하였고, 0.2 mL의 용해액［0.2 M Tris (pH7.6)+0.1% Triton X-100］으로 용해하여, 채집하였다. 상 층액의 luciferase와 -galactosidase 활성도를 분석하였다.

Luciferase의 활성도는 10 L의 추출물을 사용하여, tritium channel을 사용한 섬광 분광계(Beckman liquid scintillation spectrometer)로 계산 하였다.

Relative Luciferase Activity

7

6

5

4

3

2

1

0

Control Titanium EGF LPA

Relative Luciferase Activity

7

6

5

4

3

2

1

0

Control Titanium EGF LPA

Fig. 2.Elk-1/p62^TCF-independent pathway to c-fos SRE by Titanium-particles. (A) Diagram of the pSRE-luciferase reporter gene plasmid.

The structures of the constructs containing the wild-type or mutant SRE oligonucleotide sequences (23-mers) that are inserted into the - 53 position of the truncated c-fos promoter which is fused to the luciferase gene are shown. The methylation interference pattern for the SRF ternary complex with Elk1/p62^TCFis indicated by solid circles. The mutant SRE has two point mutations (AGG to TGT) that abolish the SRF-Elk1/p62^TCFformation in the Elk/p62^TCF-binding region. (B) Elk-1/p62^TCF-independent pathway of Titanium to c-fos SRE. Rat-2 cell cultures that were not confluent only were transiently transfected with 3 g of pSREwt-Luc plasmids and cultured for 36 h in DMEM con- taining 0.5%FBS. Titanium-particles (0.1 mg/mL) was treated for 3 h before harvest, and the luciferase and -galactosidase activities were measured as described in the Materials and Methods section. EGF (50 ng/mL) and LPA (2 m) were treated for 2 h before the cell harvest. Values are representative of triple transfections. (C) No inhibition of Titanium-induced SRE activation by pCGN1-MEK1/DN. A reporter gene plasmid, pSRE-Luc (3 g) was transiently co-transfected with 5 g of pCGN1-MEK1/DN, which is a dominant negative MEK1 expression plasmid as described in the Materials and Methods. Transfected cells were serum-deprived in DMEM containing 0.5%

FBS for 36 h before treatment with the Titanium-particles (0.1 mg/mL), EGF (50 ng/mL), LPA (2 M). After the treatment, the luciferase activities were measured and normalized to the co-transfected -galactosidase activities. Values are representative of triple transfec- tions.

insert

Luciferase Gene

SRE-wt AGGATGTCCATATTAGGACATCT SRE-mt tGtATGTCCATATTAGGACATCT

-53 TATA +1 +45

A

C B

pSRE-Luc pSREmt-Luc

pCGN1 MEK1/DN

3. LTB

PGE

Rat-2 또는 Rat-2RacN17^Asp17 세포를 60 mm 배양접시에 분주하여(3×10⁵ ea/well), 10% 우태아혈청이 첨가된 DMEM 에서 24시간 배양하였다. 이후 24시간 동안 배양매체를 0.5%

우태아혈청을 포함하는 DMEM으로 교환하였고, 지정된 시간대 로 0.1 mg/mL의 티타늄 마모편 입자로 처리하였다. 세포내 LTB⁴의 양을 측정하기 위해서, 평판을 저온 PBS로 2회 세척 후, 4배 용적의 무수에탄올과 혼합하여, 4℃에서 30분간 방치하 였다. 발생한 침전물을 4℃에서 30분간 10,000 rpm으로 원심분 리하여 제거한 후, LTB⁴을 포함한 ethanolic 상층액을 C2 reverse phase column (Amersham Pharmacia Biotech, RPN 1903)을 통해 채집하였다. 진공에서 ethanol을 증발시킨 후, 표본을 assay buffer 내에서 재구성하여, -50℃의 argon 분 석완충액에 저장한 후 specific ELISA kit (Amersham Phar- macia Biotech, RPN 222)로 분석하였다. 결과를 LTB⁴ 농도 로그 함수 표준곡선에 의해 계산하였다. PGE²는, Rat-2 또는 Rat-2RacN17^Asp17 세포를 standard 96-well microtitre plate 에 분주 시킨후(1×10⁴ ea/well), LTB⁴와 같은 방법으로 처리 하여 측정 하였다. LTB⁴와 PGE² 분석의 통계학적 유의성은 각 각 ANOVA test (p＜0.05)와 unpaired t-test (p＜0.01)로 평가 하였다.

결 과

1.

c-fos SRE

티타늄의 신호 전달계 분석의 첫 단계로, 티타늄이 c-fos SRE를 활성화시키는지에 대하여 실험하였다. 티타늄 입자의 첨 가에 의해 luciferase 활성도가 증가 하였다(Fig. 1). 티타늄 입 자(0.1 mg/mL)의 첨가 3시간 후 luciferase 활성도가 2.2배로 증가 하였으며, 그 후 다시 감소하였다. 티타늄 입자는 0.1 mg/mL의 농도에서 최대치의 luciferase 활성도가 관찰 되었다.

한편c-fos SRE가 제거된 vector인 pO-Luc으로 과도이입 한 Rat-2 세포주에서는, 티타늄 입자의 첨가에 의해 luciferase의 활성이 증가되지 않았다. 이 결과들은 Rat-2 섬유아세포에서의 c-fos SRE는 티타늄 입자에 의한 핵 표적 서열 중의 하나라는 것을 의미한다.

2.

Ras/MAP Kinase

티타늄 입자로 유발되는 c-fos SRE 활성화에 Ras/MAP Kinase 경로가 작용하는지 알기 위해 Elk-1p62^TCF가 결손된 변 이형 oligonucleotide (AGG to TGT)를 포함하는 pSREmt- Luc를 이입하여 실험하였다¹⁴⁾. 그 결과 티타늄 입자는

pSREmt-Luc과 pSREwt-Luc을 동일한 정도로 자극하였다 (Fig. 2B). 유사하게, Elk-1p62^TCF 비의존성으로c-fos SRE를 활성화시키는 lysophosphatidic acid (LPA; 10 M)는 pSREmt-Luc과 pSREwt-Luc를 동일한 수준으로 자극하였다 (Fig. 2B). 즉 티타늄에 의한 c-fos SRE로의 신호 전달은 Elk-1p62^TCF 경로와는 별개로 작용한다는 것을 의미한다(Fig.

2B). 대조실험으로 EGF (50 ng/mL)는 pSRE-mt를 pSRE- wt 보다 적은 정도로 자극시켰다. 이것은 EGF가c-fos SRE 를 활성화하기 위해서는 Elk-1p62^TCF 경로가 더 중요하다는 것 을 의미한다. 상기의 결과들은 Titanium 입자의c-fos SRE로 의 신호 전달에 Ras-MAP kinase 경로가 관여 하지 않는다는 것을 의미한다.

이점을 다시, MEK 억제제가 티타늄에 의한c-fos SRE 활성 을 억제할 수 있는지 실험 하였다. 그 결과, PD098059 (1 M;

MEK 억제제)에 의한 억제 효과는 나타나지 않았으므로, 본 cascade는 MAP kinase 신호 전달계와 다른 경로로 전달된다 고 볼 수 있다(Table 1). 또한, MEK1-DN mutant을 이입한 MEK-1의 우성결손변이형은 티타늄 신호 전달에 대해 억제 효 과를 가지지 않았다(Fig. 2C). 반면, 대조 실험으로서 EGF에 의한 신호 전달계에서는 억제가 발생하였다. 이러한 결과에 의 해, 티타늄의c-fos로의 신호전달계에서, Ras-MAP kinase 경 로가 관여할 가능성은 배제되었다고 볼 수 있다.

3.

Rac GTPase

Rho family의 small GTPase가 관여할 가능성에 대해 분석 하기 위하여 pSRE-Luc (3 g)을 대조군인 pEXV (5 g)와 Rac1의 우성결손변이형으로 부호화한 pEXV-RacN17 (5 g)

* Values in percentage.

A reporter gene plasmid, pSRE-Luc (3 g), was transiently transfect- ed. Various inhibitors were pretreated each time before the addition of Titanium-particles (0.1 mg/mL). MAFP (5 M), MK886 (50 nM), Indomethacin (10 M), Aspirin (1 M), NS-398 (10 M), PD098059 (10 M), Wortmannin (50 nM). Two hours (3 h for the Titanium-particles) later, the luciferase activities were measured and normalized to the co- transfected -galactosidase activities. The results are the means of ± S.D. obtained from three samples.

Relative Luciferase Activity Inhibitors

Dosage - (%) Titanium (%)

- - 1.0±0.1 (100)* 2.3±0.1 (100)

MAFP 5 M 1.0±0.1 (100) 1.0±0.1 (43) MK886 50 nM 1.0±0.0 (100) 1.3±0.2 (56) INDOMETHACIN 10 M 1.0±0.2 (100) 1.0±0.2 (43) ASPIRIN 1 M 1.0±0.2 (100) 1.1±0.2 (48) NS-398 10 M 1.0±0.0 (100) 1.3±0.1 (56) PD098059 10 M 1.0±0.1 (100) 2.2±0.4 (96) WORTMANNIN 50 nM 1.0±0.3 (100) 1.2±0.1 (52) Table 1.Effect of Various Inhibitors in Titanium-induced SRE Activation

로 공동이입 하였다. 그 결과, 티타늄 입자가 유발하는 c-fos SRE-luciferase의 활성이 pEXV-RacN17에서는 59%로 감소 되었다(Fig. 3A). 즉 티타늄 입자가 유발하는c-fos SRE 활성 화 경로에는 Rho family의 small GTPase 단백질의 일종인 Rac이 필요하다는 것을 알 수 있다. 또한 Rac의 연관성을 Rat- 2와 Rat2-RacN17에서 SRE-luciferase 활성도를 비교하여 다 시 분석한 결과, 티타늄 입자는 Rat-2-luciferase 보다, Rat-2- RacN17-luciferase 활성을 더 적게 유발하였다(Fig. 3B). 대조 실험에서, LPA (1 M)는 SRE-luciferase 활성을 Rat-2와 Rat-2 RacN17에서 모두 동일한 정도로 자극하였다. 이러한 결 과들로 볼 때, 티타늄-c-fos SRE의 신호계에서 Rac의 역할이 필요함을 알 수 있다.

4.

cPLA

, Lipoxygenase

Cyclooxy- genase

일반적으로, Rac-c-fos SRE의 신호 전달계에서 cPLA²가 Rac의 중요한 하류 전달체로서 기여한다고 알려져 있다^15,16). 그 러므로, 티타늄과 Rac의 관계를 고려할 때, 티타늄-c-fos SRE 신호계에서 cPLA²가 하류전달체로 관여할 가능성을 생각할 수 있다. MAFP (5 M; cPLA² 특이적 억제제)는 티타늄에 의 한 c-fos SRE활성을 완전히 억제하였다(Table 1). 동일하게 MK886 (50 nM; 5-Lo 억제제), Aspirin (1 M ; COX 억 제제), NS-398 (10 M; COX-II 선택적 억제제) 모두가 c- fos SRE 활성을 억제 하였다. 이러한 결과들은, cPLA² 그리 고 lipoxygenase (Lo)와 cyclooxygenase (COX)에 의한 arachidonic acid (AA) 대사가 티타늄-c-fos SRE의 신호 전 이에 관여한다는 것을 나타낸다.

5. Rac-

: Titanium

eicosanoids

티타늄 입자에 의해, 섬유 아세포에서도 eicosanoids의 합성이 유발되는지를 확인하기 위해, LTB⁴와 PGE²의 세포 내 변화를 측정하였다. 티타늄 입자(0.1 mg/mL)로 처리 후 30분 뒤에, LTB⁴와 PGE²의 양이 최대(기준치의 약 4배 이상)로 증가하였 다(Fig. 4). 그 다음 티타늄 입자에 의한 eicosanoids 합성 유발 경로가 Rac-cPLA²에 의존하여 작용하는지 분석하였다. 그 결 과 티타늄에 의한 PGE²의 증가는 Rat2-RacN17 clone에서는 일어나지 않았으며, 동일한 현상이 LTB⁴에서도 나타났다(Fig.

4). 이러한 결과들은 티타늄에 의한 eicosanoids의 합성 유발 기 전에는 Rac GTPase가 필요하다는 것을 의미한다. 유사하게 cPLA²의 특이적 억제제인 AACOCF3 (10 M)로 전처치 한 경우에도 LTB⁴와 PGE²의 합성이 현저히 감소 되었다(Fig. 5).

최근 Rac, cPLA², phosphatidylinositol 3-kinase (PI3- kinase)의 활성이 tumor necrosis factor- (TNF- )에 의한 LTB⁴ 합성의 경로에 관여한다는 것이 알려졌다¹⁶⁾. 따라서, PI3-kinase가 티타늄에 의한 eicosanoids 합성에 연관되는지를 분석하였다. 그 결과 티타늄 입자에 의한 LTB⁴와 PGE²의 합성 은 PI3-kinase 억제제인 Wortmannin (50 nM)에 의해 현저 히 감소 되었다(Fig. 5). 이 결과는 PI3-kinase가 티타늄에 의 한 eicosanoids의 합성 기전에 연관됨을 나타낸다. 그러므로 이 상의 결과들은 PI3-kinase, Rac, 그리고 cPLA²가 티타늄에 의 한 eicosanoids의 합성 기전에 연관되어 되어 있으며, 이러한 eicosanoids의 합성은 티타늄에 의한c-fos SRE로의 신호전달 경로에 주요한 작용을 한다고 여겨진다.

Relative Luciferase Activity

7

6

5

4

3

2

1

0

Buffer Titanium LPA

Relative Luciferase Activity

7

6

5

4

3

2

1

0

Buffer Titanium LPA

Fig. 3.Role of Rac in the Titanium-induced signaling to c-fos SRE. A reporter gene plasmid, pSRE-Luc (3 g) was transiently co-trans- fected with 5 g of pEXV, pEXV-RacN17. (A) The effect of Rac was analyzed using Rat2-RacN17 cells. (B) Transfected cells were serum- deprived in 0.5% FBS/DMEM for 36 h before being treated with Titanium-particles (0.1 mg/mL), LPA (2 M). After the treatment, the luciferase activities were measured and normalized to the co-transfected -galactosidase activities. Values are representative of triple transfections.

Mock

pEXV Rat-2

Rat-2 RacN17 RacN17

B A

고 찰

본 실험에서 티타늄 입자가c-fos SRE의 활성을 증가시키는 것이 확인되었다. 이는 Rat-2 섬유 아세포에서 c-fos SRE는 티타늄 입자에 의한 핵 표적 서열 중의 하나라는 것을 의미한다.

또한, c-fos SRE로 전이되는 티타늄의 신호계에서 Rac, cPLA², 5-Lo, 그리고 COX가 필수적인 하류 전달체로서 작용 한다는 것을 제시하였다. 또한 티타늄에 의한 본 ‘Rac-

cPLA²- eicosanoids- c-fos 신호전달계’는 LTB⁴와 PGE² 등 의 염증 매개체의 합성을 유발하는 신호기전이 될 수 있을 가능 성이 있다.

MAP kinase는 extracellular signal-regulated protein kinase (ERK)로도 알려져 있다. 이는 성장인자 등의 외부의 자극에 의한 분열촉진 신호전달의 중심역할을 수행하며, ser- ine/threonine kinase로서 세포의 생장과 분화에 중요한 유전자 발현을 조절한다^1,21). 삼성분 복합체 인자(ternary complex

LTB4(pg/mL)

180 160 140 120 100 80 60 40 20

0

0 10 20 30 40 50 60 70

PGE2(pg/mL)

120

100

80

60

40

20

0

0 10 20 30 40 50 60 70

Fig. 4.Enhanced synthesis of LTB4and PGE2by Titanium in a Rac-dependent manner. (A) Rat-2 and Rat2-RacN17Asp17were exposed to 0.1 mg/mL Titanium-particles for the indicated time periods, and then the intracellular LTB4and PGE2were assayed using a specific ELISA. (B) Rat-2 and Rat2-RacN17^Asp17cells were treated with Titanium-particles for the indicated time, after which the intracellular PGE2

was assayed as described in Materials and Methods section. Data are expressed as the means ±S.D. of three independent experi- ments. The statistical significance of LTB4and PGE2assays was assessed with an analysis of variance (p<0.01).

Rat-2 Rat-2 RacN17 Rat-2

Rat-2 RacN17

Titanium-particle (mins) Titanium-particle (mins)

LTB4(pg/mL)

120 100 80 60 40 20 0

PGE2(pg/mL)

300

250

200

150

100

50

0

Buffer Titanium

Fig. 5.Effects of Wortmannin and AACOCF3 on Titanium-particles-induced synthesis of LTB4and PGE2. (A) Rat-2 cells were exposed to 0.1 mg/mL Titanium-particle for 30 min in the presence or absence of Wortmannin (0.1 M) or AACOCF3 (10 M) and then intracellular LTB4was assayed using a specific ELISA. Inhibitors were added for 30 min prior to addition of the Titanium-particles. (B) Rat-2 cells were treated with 0.1 mg/mL Titanium-particles for 30 min, after which the intracellular PGE2was assayed as in the procudure A. Data are expressed as the mean ±S.D. of three independent experiments. The statistical significance of the LTB4assays and the PGE2

assays was assessed with the ANOVA test (p<0.05) and the unpaired t-tests (p<0.01), respectively.

Buffer Titanium Titanium+WortmanninTitanium+AACOCF3

Buffer Wortmannin AACOCF3

B A

B A

factors; TCFs)중 하나인 Elk-1p62^TCF는 MAP kinase 경로 로 알려진 Ras-Raf-ERK cascade의 활성화에 반응하여c-fos SRE를 조절하는 것으로 알려져 있다^2,4,27). Ras family G-단백 은 성장인자 등으로부터 들어오는 신호를, 세포분열의 주기를 조절하는 Ras/MAP kinase pathway로 전달하는 신호 전달 단백이다¹⁾. 최근 Rho family GTPases는, serum response factor (SRF)의 직접적인 활성화와 연관된 MAP kinase 비의 존성 경로를 통해c-fos SRE 활성화 신호 전달계에 역할을 하 는 것이 밝혀졌다¹²⁾. 따라서, c-fos SRE는, Elk-1p62^TCF 의존 성 경로 뿐만 아니라, 비의존성 신호 경로계를 통해 활성화 될 수 있다. 본 연구의 결과에 의해 티타늄의 c-fos로의 신호전달 계에서 Ras-MAP kinase 경로가 관여할 가능성은 배제되었다 고 볼 수 있다.

G-단백 superfamily 중에서 Rho family에 속하는 Rac GTPases는 Ras와 마찬가지로, GTPase activating protein (GAP)들에 의해 같은 방식으로 조절된다¹⁾. Rac은, 성장 인자 에 의한 actin filament의 재기질화, 즉 세포막 파상운동(mem- brane ruffling)을 조절한다^10,22). 또한 세포 형질전환과 G세포 주기진행을 포함하는 넓은 범위의 생물학적 과정 조절에도 연관 되어져 왔다¹⁰⁾. 최근에는 C²-ceramide, cytokines, environ- mental stresses 등에 의한 신호 전달에도 Rac이 관여 한다고 보고되고 있다^2,12). 티타늄 입자는 세포에 대해서 이물질이므로, 일종의 agonist로 작용하여, Rac과 연관된 신호전달계를 자극할 수 있을 것이다. 예상대로, Rac1의 우성 결손 변이형으로 이입 한 pEXV-RacN17에서 티타늄 입자가 유발하는c-fos SRE 활 성화가 의미 있게 감소 하였다(Fig. 3). 이것은 c-fos SRE에 대한 티타늄의 신호전달계에서 Rac단백의 활성이 필수적이라는 것을 의미한다.

일반적으로, Rac의 활성화에 의해 AA가 유리된다는 것은 이 미 잘 알려져 있으며, 이러한 AA의 유리와 그 대사과정들이 바 로 Rac이 섬유 아세포의 actin 개작에 영향을 주는 분자생물학 적 기전으로 알려져 왔다^15,16,19). 저자들도 Rac이c-fos SRE를 활성화 시키는 신호전달 경로에서‘cPLA²-AA’신호전달계가 매개하는 것을 보고한 바 있다²⁹⁾. 또한 최근에는‘Rac-cPLA²- AA’신호전달계가 hydrogen peroxide, ceramide, TNF- , Fas ligand, UV, 혹은 lipid second messenger 등에 의한 신 호 전달에 관여한다고 밝혀졌다⁹⁾. 본 신호전달계가 파골 세포에 서도 작용할 경우 Rac과 c-fos의 활성화를 통해 actin 개작 (remodeling)과 세포막 파상운동을 조절하여 파골 세포의 분화 와 증식의 key regulator로서 작용할 가능성이 있다⁸⁾. 그러나, 이점은 향후 파골 세포에서 직접 연구해야 할 내용이며, 세포 조작이 쉽지 않아 많은 어려움이 따를 것으로 생각 된다.

마모편에 의해 초래되는 삽입물 주위 골용해의 골-삽입물 경 계막(interfascial membrane)에서는 PGE² 농도가 증가되는 것 으로 알려져 있다^5,6,7,23). 본 연구에 의한 티타늄의 신호전달계에 서는, Rac과 cPLA²에 아주 의존적인 양식으로 eicosanoids의

합성이 증가하였다(Fig. 4). 또한 PI3-kinase가 티타늄에 의한 eicosanoids의 합성 기전과c-fos SRE활성화에 연관됨을 고려 하면 PI3-kinase와 함께 Rac의 하류전달체로서 cPLA², 5-Lo 와 COX에 의한 eicosanoids 합성 기전이 티타늄의c-fos SRE 로의 신호전달계에 주요한 작용을 한다고 여겨진다(Table 1)(Fig. 5).

마모편 입자들에 의한 골용해 과정에는, PGE² 이외의 다른 인자나 기전, 소위‘PG 비의존성 기전’으로서의 몇 가지의 신 호 전달계가 존재 할 것으로 생각할 수 있다3,5,7,8,17). TNF- , interleukin-1과 interleukin-6 같은 proinflammatory cytokine 들이 골용해 과정에 연관되어 있다^11,13,23). 섬유 아세포에서c- fos SRE가 PI3-kinase, Rac, cPLA²의 순서를 거치며, LTB⁴ 를 생성하면서 TNF- 의 표적 서열로 작용 할 수 있다^9,16). 그 러므로 티타늄이 TNF- 등의 proinflammatory cytokine들과 함께 작용하면서‘Rac- cPLA²- eicosanoids-c-fos 신호전달 계’를 유도할 가능성이 입증되면 골 용해의 PG 비의존성 기전 은 물론, PG 의존성 경로의 일부가 밝혀질 수 있을 것이다. 또 한 본 신호전달계는 염증 반응을 유발하는 eicosanoids의 합성 기작의 하나일 가능성도 있다.

결 론

티타늄 입자의 자극에 의해 Rat-2 섬유 아세포의c-fos SRE 활성이 증가하며, 이 과정에서 Rac, cPLA², 5-Lo, 그리고 COX의 작용이 필수적이다. 그러므로 티타늄에 의한 c-fos SRE의 활성화 경로에는‘Rac- cPLA²- eicosanoids- c-fos 신호전달계’가 존재한다.

참고문헌

1. Cho TJ, Choi IH, Chung CY, Sung HY, Sohn YJ and Kim DW:

Molecular characterization of congenital pseudoarthrosis of the tibia asso- ciated with neurofibromatosis. J. of Korean Orthop. Assoc. 35: 825-831, 2000.

2. Cosa OA, Chiariello M, Yu JC, et al:The small GTP-binding proteins Rac1 and CDC42 regulate the activity of the JNK/SAPK signaling path- way. Cell, 81: 1137-1146, 1995.

3. Eriksson AS and Thomsen P:Leukotrien B4, Interleukin-1 and leuko- cyte accumulation in titanium and PTEF chambers after implantation in the rat abdominal wall. Biomaterials, 12: 827-830, 1991.

4. Gille H, Sharrocks AD and Shaw PE:Phosphorylation of transcrip- tion factor p62TCF by MAP kinase stimulates ternary complex formation at c-fos promoter. Nature, 358: 414-417, 1992.

5. Glant TT, Jacobs JJ, Mikecz K, et al: Particulate-induced

prostaglandin and cytokine mediated bone resoption in an experimental system and in failed joint replacements. Am J Ther, 3: 27-41, 1996.

6. Goldring SR, Schiller A, Roelke M, O’’Neill D and Harris W: The synovial-like membrane at the bone-cement interface in loose total hip replacements and its proposed role in bone lysis. J Bone Joint Surg, 65(A):

575-584, 1983.

7. Goodman SB, Chin R and Magee F:Prostaglandin E2production by the membrane surrouding loose and fixed cemented tibial hemiarthroplas- ties in the rabbit knee. Clin Orthop, 284: 283-287, 1992.

8. Grigoriadis AE, Wang ZQ, Cecchini MG, et al:C-fos: a key regula- tor of osteoclast macrophage lineage determination and bone remodeling.

Science, 21; 266: 443-448, 1994.

9. Haliday EM, Ramesha CS and Ringold G:TNF induces c-fos via a novel pathway requiring conversion of arachidonic acid to a lipoxigenase metabolite. EMBO J, 10: 109-115, 1991.

10. Hall A: Small GTP-binding proteins and the regulation of the actin cytoskeleton. Annu Rev Cell Biol, 10: 31-54, 1994.

11. Haynes DR, Boyles SJ, Rogers SD, Howie DW and Vernon- Roberta B:Variation in cytokines induced by particles from different prosthetic materials. Clin Orthop, 352: 223-230, 1998.

12. Hill CS, Wynne J and Treisman R:The Rho family GTPase RhoA, Rac1 and CDC42Hs regulate transcriptional activation by SRF. Cell, 81:

1159-1170, 1995.

13. Jiranek W, Machado M, Jasty M, et al:Production of cytokines around loosened cemented acetabular components. Analysis with immunohistochemical techniques and in situ hybridization. J Bone Joint Surg, 75(A): 863-879, 1993.

14. Johansen FE and Prywes R:Two pathways for serum regulation of the c-fos serum response element require specific sequence elements and a minimal domain of serum response factor. Mol Cell Biol, 14: 5920-5928, 1994.

15. Kim BC and Kim JH:Nuclear signaling by Rac GTPase: Essential role of phospholipase A2. Biochem J. 326: 333-337, 1997.

16. Kim BC, Lee MN, Kim JY, et al:Role of phosphatidylinositol 3-Kinase and Rac in the nuclear signaling by tumor necrosis factor- in Rat-2 fibroblasts. J Biol Chem, 274: 24372-24377, 1999.

17. Lerner UH and Ohlin A: Tumor Necrosis Factors alpha and beta can stimulate bone resorption in cultured mouse calvariae by a prostaglandin independent mechanism. J Bone Miner Res, 8: 147-155, 1993.

18. Miyauchi A, Kuroki Y, Fukase M, Fujita T, Chihara K and

Shiozawa S:Persistent expression of proto-oncogene c-fos stimulates osteoclast differentiation. Biochem Biophys Res Commun, 30: 1547-1555, 1994.

19. Peppelenbosch MP, Tertoolen LGJ, Hage WJ and De Laat SW:

Epidermal Growth Factor-induced Actin remodeling is regulated by 5- Lipoxygenase and Cyclooxygenase products. Cell, 74: 565-575, 1993.

20. Piechaczyk M and Blanchard JM: C-fos proto-oncogene regulation and function. Critical Reviews in Oncology/Hematology, 17: 93-131, 1994.

21. Reobuck KA, Jacobs JJ and Glant TT: New horizons in orthopaedic research: elucidation of cellular signal transduction pathways. J Bone Joint Surg, 81(A): 599-602, 1999.

22. Ridley AJ, Peterson HF, Johnston CL, Diekmann D and Hall A:

The small GTP-binding protein Rac regulates growth factor-induced membrane ruffling. Cell, 70: 401-410, 1992.

23. Shanbhag AS, Jacobs JJ, Black J, Galante JO and Glant TT:Cellu- lar mediators secreted by interfacial membranes obtained at revision total hip arthroplasty. J Arthroplasty, 10(4): 498-506, 1995.

24. Shanbhag A, Jacobs JJ, Black J, Galante JO and Glant TT:Effect of particles on fibroblast proliferation and bone resorption in vitro. Clin Orthop, 342: 205-217, 1997.

25. Treisman R:The SRE: A growth factor responsive transcriptional regu- lator. Seminar in Cancer Biology, 1: 47-58, 1990.

26. Vermes C, Roebuck KA, Chandrasekaran R, Dobai JG, Jacobs JJ and Glant TT: Particulate wear debris activates protein kinases and nuclear factor B, which down-regulates type I collagen synthesis in human osteoblasts. J Bone Miner Res, 15: 1756-1764, 2000.

27. Whitmarsh AJ, Shore P, Sharrocks AD and Davis RJ:Integration of MAP kinase signal transduction pathways at the Serum Responsive Element. Science, 269: 403-407, 1995.

28. Woo CH, Eom YW, Yoo MH, et al:TNF- generates Reactive Oxy- gen Species generation via cPLA2-linked cascade. J Biol Chem, 275(41):

32357-32362, 2000.

29. Woo CH, Kim BC, Kim KW, et al:Role of cytosolic phospholipase A2

as a downstream mediator of Rac in the signaling pathway to JNK stimu- lation. Biochem Biophys Res Commun, 268(1): 231-236, 2000.

30. Yao J, Glant TT, Lark MW, et al:The potential role of fibroblasts in periprosthetic osteolysis: Fibroblast response to titanium particles. J Bone Miner Res, 10: 1417-1427, 1995.

Purpose :In order to understand the intracellular signaling pathway involving the c-fos gene expression that is caused by Titanium-particles, we analyzed the involvement of Rac, cytosolic phospholipase A2, and eicosanoids (e.g. leukotriene B4and prostaglandin E2) as well as c-fos.

Materials and Methods :We tested whether or not Titanium-particles activate a c-fos serum response element in Rat-2 fibroblasts. To measure the activity of the c-fos serum response ele- ment, we analyzed the serum response element using a luciferase reporter system. The luciferase activity was measured using a scintillation spectrophotometer. Next, we analyzed the involvement of Rac and the eicosanoid synthesis mechanisms which are downstream mediators of Rac in the c-fos serum response element activation cascade.

Results : Titanium-particles cause an activation of the c-fos serum response element and this activation was selectively repressed by RacN17 and by pretreatment of the inhibitors of cytosolic phospholipase A2, cyclooxygenase or 5-lipoxygenase. Eicosanoid synthesis was increased in a Rac-dependent manner in response to the presence of Titanium- particles.

Conclusion :‘Rac, a member of G-protein, which is involved in the eicosanoid synthesis’may play a critical role in the Titanium-induced signaling cascade. Thus, we speculated that the ‘Rac- cytosolic phospholipase A2-eicosanoids-c-fos cascade’may be a possible mechanism that pro- duces eicosanoid synthesis caused by Titanium-particles in the periprosthetic osteolytic process.

Key Words : Fibroblast, Titanium, Rac, Eicosanoid, c-fos

The Signaling Pathway of G-protein Rac and Eicosanoid Synthesis by Titanium Particles

Sang-Soo Lee, M.D., Jae-Young Her, M.D., Chang-Hoon Woo, M.S.*, Jae-Hong Kim, Ph.D.*, and Jun-Dong Chang, M.D.**

Department of Orthopaedic Surgery, Pohang St. Mary’s Hospital, Pohang; Graduate School of Biotechnology, Korea University, Seoul*; Department of Orthopaedic Surgery, College of Medicine, Hallym University, Seoul, Korea**

Abstract

Address reprint requests to Jun-Dong Chang, M.D.

Department of Orthopaedic Surgery, Hangang Sacred-Heart Hospital 94-200 Youngdeungpo-dong, Youngdeungpo-gu, Seoul 150-020, Korea Tel: +82-2-2639-5301 Fax: +82-2-2631-9337

E-mail: [email protected]

1. 제 3차 아시아 태평양 인공관절 학술대회

제 3차 아시아 태평양 인공관절 학술대회(The 3rd Asia-Pacific Arthroplasty Society 2001, Seoul, Korea 일명 APAS 2001, Seoul)가 2001년 9월 13(목)-16일(일)서울 조선호텔에서 개최됩니다. 대회 내용은 인공 고관절, 슬관 절 분야의 심포지움, 세계적인 관절염 분야 권위자의 초청특강, 논문발표, 포스터 전시, 의학기기 전시로 구성되며,이 번 학술대회에 국내 정형외과 의사들의 많은 참여를 바랍니다. 홈페이지로 등록 및 초록접수가 가능합니다.

�일 시: 2001년 9월 13(목)-16일(일) 4일간

�장 소: 서울 웨스턴 조선호텔(1층 회의장, 2층 전시장)

�주 제: “Toward the perfect artificial joints”

�회의구성: -인공 고관절,인공 슬관절 분야의 심포지움 -초청연사의 특강

-논문발표 -포스터 전시 -의학기기 전시

�예상 참가국: 아시아 태평양 16개국외(한국, 일본, 호주, 뉴질랜드, 중국, 대만, 홍콩, 인도, 태국, 베트남, 말레이시 아, 파키스탄, 필리핀, 싱가포르, 인도네시아 외 …)

�공식언어: 영어

�주 최: 아시아 태평양 인공관절 학회 서울 사무국(조직위원장: 경희대학교 유명철 교수)

�후 원: 대한고관절학회, 대한슬관절학회

�회의 사무국: (주)한진관광 APAS 2001 Seoul 사무국, 담당: 김성민 서울특별시 중구 소공동 51 해운센터 신 관 5층 100-770

Tel : 02-726-5557, Fax : 02-778-2514,

E-mail : [email protected]

정형외과학 교실 소식