Pomegranate (Punica granatum L.) Peel Extract Inhibits Quorum Sensing and Biofilm Formation Potential in
Yersinia enterocolitica
Soo Kyung Oh1, Hyun Joo Chang2, Hyang Sook Chun3, Hyun Jin Kim4, and Nari Lee1*
1Research Group of Gut Microbiome, 2Research Group of Food Safety, Korea Food Research Institute, Seongnam 13539, Republic of Korea
3School of Food Science and Technology, Chung-Ang University, Ansung 17546, Republic of Korea
4Division of Applied Life Sciences (BK21 plus), and Department of Food Scienceand Technology, Gyeongsang National University, Jinju 52828, Republic of Korea
Received: October 13, 2015 / Revised: November 10, 2015 / Accepted: November 17, 2015
Introduction
Quorum sensing (QS) is a communication system that allows bacteria to monitor their population density and con- trol a variety of physiological processes such as virulence, biofilm formation, swimming, and motility by releasing and receiving small signal molecules called autoinducers [5]. N- acyl-homoserine lactones (AHLs) are the main autoinduc- ers produced by Gram negative bacteria, such a Pseudo-
monas aeruginosa and Yersinia spp. [12, 14].
The genus Yersinia comprises human pathogenic spe- cies such as the enteropathogenic Yersinia enterocolitica.
This pathogenic bacterium causes gastrointestinal infec- tions after the consumption of contaminated foods [13]. Y.
enterocolitica uses AHLs as QS signal molecules to coordi- nate the expression of multifarious genes [12]. The synthe- sis of AHLs by Y. enterocolitica is regulated by yenI, a gene encoding an AHL synthase, and a gene encoding a tran- scriptional activator named yenR [26]. In response to envi- ronmental signals, QS also controls swimming and motility in Y. enterocolitica by regulating three major flagellar gene classes [4]. The flhDC (class I) is required for the expres- Quorum sensing (QS) is involved in the process of cell-to-cell communication and as a gene regulatory mechanism, which has been implicated in bacterial pathogenicity. Bacteria use this QS system to control a variety of physiological processes. In this study, pomegranate (Punica granatum L.) peel extract (PPE) was first screened for its ability to inhibit QS in bio-reporter strains (Chromobacterium violaceum and C. violaceum CV026). Next, the ability of PPE to inhibit swimming motility and bio- film formation was examined in Y. enterocolitica. Additionally, changes in the expression of specific genes involved in the syn- thesis of the N-acylhomoserine lactones (AHLs; yenI and yenR) and in the flagellar regulon (fliA, fleB and flhDC) were evaluated by reverse transcription (RT)-PCR. The results show that PPE specifically inhibited and reduced QS-controlled vio- lacein production by 78.5% in C. violaceum CV026, and decreased QS-associated biofilm formation and swimming motility in Y. enterocolitica without significantly affecting bacterial growth. These inhibitory effects were also associated with the down- regulation of gene expression involved in the synthesis of AHLs and in motility. Our results suggest that PPE could be a potential therapeutic agent to prevent enteropathogens in humans, as well as highlight the need to further investigate the in vivo properties of PPE for clinical applications.
Keywords: Biofilm formation, C. violaceum, pomegranate, quorum sensing, Y. enterocolitica
*Corresponding author
Tel: +82-31-780-9182, Fax: +82-31-709-9876 E-mail: [email protected]
© 2015, The Korean Society for Microbiology and Biotechnology
sion of class II genes. These code for structural and acces- sory proteins required for the assembly of the flagellum basal body and hook and also include fliA which encodes sigma factor σ28. Class III genes are transcribed from fliA- dependent promoters and encode tandem flagellin genes such as fleA, fleB and fleC [30]. It is well established that bacterial biofilms have an important role in the pathogene- sis of many human infections and increase bacterial resis- tance to antimicrobial agents. Because biofilm formation is generally determined by QS mediated phenomenon such as flagella-driven swimming [25], interfering with this phe- nomenon through quorum sensing inhibitory (QSI) com- pounds could be a suitable alterative strategy to reduce or to prevent biofilm based infections.
Pomegranate (Punica granatum L.) is rich in health-pro- moting compounds, and it has been commonly used in herbal remedies by local healers in many countries and in traditional medicine for treating diarrhea and dysentery.
Pomegranate fruit peel is characterized by containing sub- stantial levels of phenolic compounds (punicalin, gallic and ellagic acid) [9, 19] as well as flavonoids (anthocyanins, fla- vonols, and flavones) [9, 32]. Additionally, in vitro and in vivo studies have shown the antimicrobial [2, 20], anticancer [8], anti-inflammatory and antiallergic [23] properties of pomegranate peel extracts. Al-Zoreky [2] has reported that pomegranate peel extracts (PPEs) have antimicrobial activ- ity against Escherichia coli, Salmonella, Staphylococcus aureus, Yersinia enterocolitica, and fungi.
Although the antimicrobial activity of pomegranate peels has been extensively studied [2], reports on its anti-QS properties are scare. The present study investigated the ability of pomegranate peel extracts (PPEs) to inhibit the production of AHLs, QS signal molecules, as well as biofilm formation and swimming motility controlled by QS in the human pathogenic bacteria Y. enterocolitica. In addition, we examined some of the molecular changes associated with the exposure of Y. enterocolitica to PPE and the related synthesis of AHLs and motility.
Materials and Methods
Bacterial strains and culture conditions
Y. enterocolitica ATCC 9610, and C. violaceum ATCC 12472 were obtained from the American Type Culture Col- lection (ATCC, Manassas, VA, USA), and C. violaceum CV026 was kindly provided by Professor Hwang J. K.
(Yonsei University, Korea). Stocks of the strains were stored at -80°C in Luria-Bertani broth (LB broth, Difco, Bec- ton Dickinson, Sparks, MD, USA) with 30% glycerol. Unless otherwise stated, the bacterium was routinely cultured aer- obically in LB broth at 30°C with continuous agitation in a shaking incubator. The medium for C. violaceum CV026 was supplemented with 20 μg/ml kanamycin. Mueller-Hinton agar (MHA, Difco) was used to test the antibacterial activity of the pomegranate extracts.
Plant material and preparation of the extract
Pomegranate (Punica granatum L.) fruits of the wild vari- ety were purchased at the local markets in Goheung, Jeon- nam, South Korea, and their peels were separated from the seeds. The peels of the pomegranate were dried com- pletely under shade and ground to powder. Fifteen grams of powdered samples were extracted using 700 ml of 75%
(v/v) aqueous methanol for 1 day and repeated twice. The extract was filtrated with Whatman No. 1 paper (Whatman International Ltd., Maidstone, England) and concentrated (2.75 g) with a rotary evaporator (Heidolph, Schwabach, Germany) and then dissolved in dimethyl sulfoxide (DMSO, Sigma, St. Louis, MO, USA) to produce a final concentra- tion of 100 mg/ml for use in further experiments.
Determination of the minimum inhibitory concentration (MIC)
The MIC of the pomegranate (Punica granatum L.) peel extract (PPE) was determined following the guidelines of the Clinical and Laboratory Standards Institute [6]. The tested pathogens were inoculated into 20 ml of LB medium supplemented with serially twofold diluted extracts to attain final concentrations ranging from 0.1 to 20 mg/ml and incu- bated at their optimum temperature for 24 h. Before and after incubation, the absorbance of the media was mea- sured with a spectrophotometer at a wavelength of 600 nm.
The MIC is defined as the lowest concentration of PPE which showed inhibition of visible growth of the tested strains [15]. All further experiments in the present study were performed at sub-MIC concentrations of each extract.
Growth curve analysis in Y. enterocolitica
For bacterial growth analysis, diluted cultures of Y.
enterocolitica (OD600 = 0.1) were grown in sterile 96-well microtiter plates as previously described [10]. The culture conditions were as mentioned above with a final volume
250 μl per well. Plates were incubated at 30°C in the absence or presence of the PPE (the final concentrations ranging from 0.5 to 3 mg/ml) with intermittent shaking, and cell growth was determined by measuring the OD600 at 3 or 2 h intervals. LB broth containing no bacteria was used as a negative control.
Quorum sensing inhibition assay
The agar well diffusion assay was used to detect the anti- quorum sensing activity of the PPE in C. violaceum ATCC 12472 following the method of Adonizio et al. [1]. Briefly, LB agar plates were spread with 100 μl of appropriately diluted (108 CFU/ml or OD600 = 0.1) freshly grown cultures and 7- mm diameter wells were cut and various concentrations of diluted pomegranate peel extract in DMSO were loaded.
Plates were incubated for 18−24 h at 30°C, observed for any growth inhibition zones and examined for violacein pro- duction. Quorum sensing inhibition was detected by a col- orless, opaque, but viable, halo around the wells. DMSO was used as a control.
For the violacein production inhibition assay, C. viola- ceum CV026 was inoculated into 3 ml of LB medium as a starter culture and then incubated into LB medium contain- ing 50 nM N-hexanoyl-L-homoserine lactone (C6-HSL, Sigma) and a series of different concentrations of PPE (0.5 mg/ml, sub-MIC concentrations; 1.0 mg/ml, 1.5 mg/ml and 2.0 mg/ml, respectively). The control was DMSO with- out PPE and then incubated at 30°C for 24 h in a shaking incubator. The quantification of violacein production was done with the following protocol described by Choo et al.
[7], where 1 ml of each culture was centrifuge at 12,000 g for 10 min to precipitate the insoluble violacein. The culture supernatant was discarded, and the pellet was solubilized in 1 ml of DMSO, vortexed until the violacein was extracted, and centrifuged at 12,000 g for 10 min to remove any cells.
The absorbance of each violacein containing supernatant was read with a microplate reader (Molecular Devices, Sunnyvale, CA, USA) at a wavelength of 585 nm. The per- centage of violacein inhibition was calculated with the fol- lowing formula: percentage of violacein inhibition = (control OD585 – test OD585/control OD585) × 100.
Biofilm formation
The effects of the PPE on the formation of biofilms by Y.
enterocolitica were evaluated with the crystal violet assay with some modifications [11, 27]. A number of wells in a
sterile round-bottom 96-well polyvinyl chloride plate (BD Falcon, Franklin Lakes, NJ, USA) containing 160 μl of LB broth and 20 μl of the PPE were inoculated with 20 μl of a working culture of Y. enterocolitica diluted (1:100) in phos- phate-buffered saline (PBS, Difco). Control wells contained 160 μl of LB broth, 20 μl of sterile water or an equivalent amount of DMSO (< 0.1%), and 20 μl of a working culture of Y. enterocolitica. After 24 h of incubation, the absorbance of the well was measured at 600 nm to study the effect of the PPE on the growth of Y. enterocolitica. Subsequently, the planktonic cells were removed by rinsing the wells twice with phosphate-buffered saline. The biofilm layer formed on the wall of the wells was fixed with 200 μl of acidified meth- anol (33% acetic acid) and stained with 200 μl of crystal vio- let (0.3%) for 10 min. The excess dye was removed by washing the wells twice with phosphate-buffered saline.
The biofilm was quantitated after solubilization of the crystal violet with 200 μl of 95% ethanol by measuring the OD595
with a spectrophotometer. Each data point was averaged from triplicate wells, and background absorbance was determined in wells containing only sterile medium (160 μl) and distilled water (40 μl).
Swimming motility inhibition assay
The swimming motility assay was determined following a previously described method [4] with some modifications.
Swimming motility was tested with the same growth medium containing 1% tryptone and 10 mM glucose sup- plemented with 0.3% Bacto agar (Difco). The inoculum was stabbed into the medium with 5 μl of an overnight culture (OD590 = 0.5) of Y. enterocolitica and incubated upright in the absence and presence of soluble PPE at 30°C for 24 h.
At the end of the incubation period, the reduction in swim- ming migration was recorded by measuring the swim zone of the bacterial cells.
Bacterial RNA extraction and Gene expression analysis Samples from the control and treated cultures (at the concentrations stated) were taken at 16 h based on the bacterial growth curve corresponding to the end of the exponential phase. Total RNA was extracted with the Qiagen Rneasy mini kit (Qiagen, Hilden, Germany) accord- ing to the manufacturer’s instructions. The purity and con- centration of the samples were checked measuring the absorbance at 260 and 280 nm using the NanoDrop 2000 (Thermo Scientific, Wilmington, DE, USA). Only RNA sam-
ples with an Abs260/Abs280 ratio between 2 and 2.2 were used for gene expression analyses.
Five genes expressed in Y. enterocolitica and reported to be involved in the synthesis of AHLs (yenI, yenR) and its motility (fliA, fleB and flhDC) were selected for this study [3, 4]. The primer pairs used for reverse transcription (RT)- PCR are based on a previous report [28] and listed in Table 1. A 1 μg sample of RNA was then reverse transcribed into cDNA with the AccuPower® Rocket RT premix (Bioneer, Daejeon, Korea) according to the manufacturer’s instruc- tions. cDNA was stored at -20°C until used. PCRs were performed in a 25 μl system that contained Accu- Power® 2 × Greenstar qPCR Master Mix (Bioneer) as rec- ommended by the manufacturer. The reactions were performed with the ABI 7500 system (Applied Biosystems, Foster City, CA, USA). The cycling conditions included 1 cycle of 95°C for 30 s, 30 cycles of 95°C for 10 s and 60°C for 40 s, and a dissociation step of 95°C for 15 s and 60°C for 25 s. All samples were analyzed in triplicate and normal- ized to the housekeeping gene 16S rRNA gene. Relative quantification based on the expression of a target gene ver- sus 16S rRNA gene was determined by the 2-∆∆CT method described previously [18].
Statistical analysis
All experiments were performed in triplicates or five replicates. The results were expressed as the means ± standard deviation (SD). The differences between the control and test were analyzed using Student’s t-test. P values less than 0.05 were considered to be statistically significant.
Results
Determination of MIC
The MIC was determined for the methanol extract of pomegranate (Punica granatum L.) peels (PPE) against Y.
enterocolitica ATCC 9610, C. violaceum ATCC 12472 and C. violaceum CV026. The pomegranate peel methanol extract (PPE) had an antimicrobial activity against each of the strains tested, and the MIC was found to be 12 mg/ml for the bio-reporter strains (C. violaceum and C. violaceum CV026), and 3 mg/ml for Y. enterocolitica. To confirm the non-antimicrobial activity of the PPE at the tested concen- trations, a bacterial growth curve assay was done for Y.
enterocolitica. The results revealed that PPE, at concentra- tions ranging from 0.5 mg/ml to 2 mg/ml, had no significant
influence on the growth of Y. enterocolitica (Fig. 1). Addi- tionally, they showed that PPE could retard the growth of Y.
enterocolitica at concentrations ranging from 2.5 to 3 mg/
ml. Hence, in the present study, the sub-MIC concentra- tions (0.5−2 mg/ml) of the test extract were used in all fur- ther experiments.
Quorum sensing inhibition by the pomegranate peel extract
The PPE had an anti-quorum sensing (anti-QS) activity in the C. violaceum ATCC 12472 biosensor bioassay. The lack of purple pigmentation from C. violaceum in the vicinity of the test extract indicated the inhibitory effect of the PPE (Fig. 2A). The white zone (26 mm) of inhibition observed was opaque and not transparent, indicating that the halo around the well was produced by the inhibition of violacein secretion, not the inhibition of cell growth.
In the violacein production inhibition assay, PPE exhibited a concentration dependent inhibition of C6-HSL- mediated violacein production in C. violaceum CV026, and violacein inhibition was observed up to a maximum of 78.5% in C. violaceum CV026 when treated with 2 mg/ml of PPE (Fig. 2B), which did not have an effect on the growth rate of C. violaceum CV026.
PPE inhibits biofilm formation in Y. enterocolitica The results of the crystal violet assay for the formation of biofilms revealed that the untreated control showed the Fig. 1. Growth curves of Y. enterocolitica cultured in LB broth with various concentrations of pomegranate peel extract (PPE). Each value represents the average of three independent experiments.
well-developed biofilm growth of Y. enterocolitica, whereas the strain treated with the extract (2 mg/ml) had poor biofilm growth compared to that of the control (Fig. 3A). In the biofilm quantification assay, a concentration dependent
decrease in biofilm formation was observed for the bacterial strain when treated with the PPE. At a concentration of 2 mg/ml, the PPE showed a maximum reduction of 81 ± 3.6% in biofilm biomass for Y. enterocolitica (Fig. 3B). It was Fig. 2. Quorum sensing inhibitory activity of the PPE against violacein production in C. violaceum. A: Effect of the PPE on inhibiting violacein production in C. violaceum. (a) DMSO as the control, (b) PPE (10 mg/ml). B: Quantitative analysis of violacein inhibition in C. violaceum CV026 by pomegranate peel extract. The cultures were grown in the presence of 0.5, 1, 1.5 and 2 mg/
ml of PPE.
Fig. 3. The inhibition of Y. enterocolitica biofilm in the presence of different concentrations of PPE. (a) Untreated control, (b) 0.5 mg/ml, (c) 1 mg/ml, (d) 1.5 mg/ml, and (e) 2 mg/ml A: Effect of PPE on biofilm formation in Y. enterocolitica. B: Quantitative analysis of biofilm inhibition in Y. enterocolitica by PPE. Data are represented as the percentage of biofilm inhibition. Each bar rep- resents the mean and standard deviations of the mean for all the measurements. *Significant at p < 0.05, **significant at p < 0.01 and ***significant at p < 0.001.
clear that PPE did inhibit biofilm formation of the test strains without inhibiting their cell growth. This result shows that the biofilm inhibition activity of PPE was not from the anti- bacterial effect.
Swimming motility inhibition by PPE in Y. enterocolitica Because swimming migration has an important role in quorum sensing-mediated biofilm formation, an effort was made to examine the anti-QS potential of PPE against QS dependent swimming motility in Y. enterocolitica. The results show a dose dependent decrease in the swimming velocity of the test strain (Fig. 4A). The maximum inhibition in swimming migration was recorded at a concentration of 2 mg/ml of PPE (Fig. 4B).
Effects of PPE on gene expression
To identify the putative molecular changes that may be associated with the decrease in the concentration of N- acylhomoserine lactones (AHLs) produced by Y. enteroco-
litica, we compared the transcript levels of specific genes involved in their synthesis (yenI and yenR) between Y.
enterocolitica cells grown in medium supplemented with dif- ferent concentrations of the PPE for 24 h. The exposure to PPE noticeably decreased the expression of both yenI and yenR (Table 1).
We next tried to verify whether treatment with PPE influ- enced the expression of some key regulatory members of involved in cell motility: fliA, fleB and flhDC. As shown in Table 1, we observed that PPE significantly (p < 0.05) reduced the expression of these genes associated with vir- ulence through motility in Y. enterocolitica below the control in a dose-dependent manner (Fig. 5). The expression level of fliA was slightly lower than that of fleB and flhDC. The most significant changes were found for fleB, which was up-regulated in Y. enterocolitica before exposure to PPE, whereas the expression of this transcript was found to be significantly down-regulated by PPE at the highest concen- tration tested (2 mg/ml).
Fig. 4. Swimming motility in Y. enterocolitica. A: Effects on migration distance of Y. enterocolitica by (a) control, (b) 0.5 mg/ml, (c) 1 mg/ml, and (d) 2 mg/ml PPE. B: Measurement of Y. enterocolitica migration in swimming motility assays. Motility was deter- mined by measuring the swimming diameter (mm) in untreated (control; DMSO) plates and treated plates with the PPE. Bars show the mean ± the standard deviation.
Discussion
There is a need to identify new and nontoxic quorum sensing inhibitory compounds, because of continuous emergence and spread of multidrug-resistant bacteria in recent years. Some studies have shown the potential use of different plant extracts (e.g., garlic, vanilla, alfalfa, and tumeric) with anti-quorum sensing activity [7, 21]. The results obtained in the present study (Fig. 2B) are compara- ble with those of Khan et al. [7], who reported a 92% inhibi- tion of quorum sensing-mediated violacein production with
CV026 from clove oil. Vattem et al. [29] also found that an aqueous extract of Rosmarinus officinalis decreased viola- cein production by 40%. Similarly, the extracts from Vanilla planifolia conferred a 98% reduction in violacein production [7]. Furthermore, Koh and Tham [16] found that extracts from Punica granatum had anti-QS activity in C. violaceum and Pseudominas aeruginosa PA01, and Truchado et al.
[28] showed that ellagic acid and pomegranate extract interfered with the quorum sensing system of Y. enterocolit- ica and Erwinia carotovora.
Obviously, quorum sensing influences the bacterial bio- film formation and biofilm formation plays a key role in the pathogenesis of bacteria. In the present study, the expo- sure with PPE at 2 mg/ml effectively reduced the biofilm biomass for Y. enterocolitica (Fig. 3B). Consistent with our findings, Rosa rugosa tea has been shown previously to inhibit the biofilm of P. aeruginosa PA01 and E. coli K-12 without affecting planktonic growth [31]. More than 60% of all infections in developed countries are caused by biofilms, which are bacterial communities that settle and proliferate on surfaces and covered by an exopolymer matrix. A high proportion of chronic infections, often untreatable, are accompanied by the formation of biofilms with a high resis- tance to antibiotics [17]. Therefore, our search for natural compounds able to attenuate bacterial pathogenicity rather than bacterial growth is important. Recently, the anti-biofilm -forming properties of several plant extracts against E. coli, V. harveyi, and P. aeruginosa were reported [21, 28].
*Truchado et al., 2012
**Values represent the mean ± the standard deviation of three independent experiments; p < 0.05 Table 1. Differentially expressed quorum sensing-controlled genes by PPE in Y. enterocolitica.
Gene Primer sequence (5'- 3')* Sequence
accession Product Relative expression**
1 mg/ml 2 mg/ml 16S F: GCCCCCTGGACAAAGACT
R: TGGACTACCAGGGTATCTAATCCT
AM286415.1 16S rRNA 1 1
yenI F: GATGTGAGCCTACCTATTGATGGTT R: CCCACCATATCTCTTGCTAATGCTT
YP_001005892.1 N-acylhomoserine lactone synthase
-0.75 ± 0.17 -4.62 ± 0.29
yenR F: CCGGTTATATTGACGGCGAAAGATA R: CGGCGGAATCCGTCGAT
AM286415.1 quorum-sensing transcrip- tional activator
-1.22 ± 0.32 -2.43 ± 0.23
fliA F: AACAACGGCTCGGACGT
R: CTGGCGGTACTCAGTCAAATCAATA
AM286415.1 RNA polymerase sigma factor for flagellar operon
-0.78 ± 0.14 -3.21 ± 0.80
fleB F: GGCGGTCGAAAGATAATGAACAAAT R: AGATTCCAGCCAGAACTTGCA
L33468.1 thermoregulated motility protein
-0.91 ± 0.05 -5.53 ± 0.63
flhDC F: GCGCGCTTGCAGATGTT R: GCTGCCTCTCAGCTCTTTATAGA
AF081587.1 motility master regulatory operon
-1.12 ± 0.07 -4.17 ± 0.77
Fig. 5. Transcriptional regulation of fliA, fleB and flhDC by PPE. Relative quantification based on the expression of a target gene versus that of the 16S rRNA gene was calculated with the 2-∆∆CT method, and values are expressed as -1/2-∆∆CT. Values represent the mean ± the standard deviation of three indepen- dent experiments. *, p < 0.05; **, p < 0.01.
Flagella-mediated swimming motility is associated with biofilm formation by instigating the cell-to-surface attach- ment [24], and has a key role in the virulence of pathogens.
In the present study, PPE effectively reduced the QS dependent swimming motility (Fig. 4B), which accounts for the formation of biofilms in many foodborne pathogens including Y. enterocolitica. Our result agrees with the find- ings of Zhang et al. [31] in which Rosa rugose tea reduced the biofilm formation of E. coli K-12 and P. aeruginosa PA01 by interfering with its swimming motility. The result was also supported by the reports of Packiavathy et al. [21, 22] in that methanol extracts of Cuminum cyminum and Curcuma longa reduced the biofilm formation of many bacteria including P. aeruginosa PA01 by inhibiting swimming motil- ity. In addition, Swift et al. [25] reported that a mutant strain with altered swimming motility was shown to be defective in biofilm formation.
We assumed that PPE could have an effect at the tran- scription level of QS-related genes, because the PPE inter- fered with QS-dependent activity in Y. enterocolitica. We first investigated the effect of the PPE on the expression levels of yenI and yenR involved in the synthesis of AHLs.
Our result exhibited that PPE down-regulated the expres- sion of both yenI and yenR (Table 1). In agreement with these results, other plant-derived compounds such as uro- lithin and ellagitannin also inhibited the production of AHLs (encoded by yenI) in Y. enterocolitica. In contrast to the results for the yenI gene, our results for the expression of yenR is not consistent with a previous study [10, 28] that showed the mRNA expression of yenR was up-regulated while the transcript level of yenR was reduced by exposure to the PPE in our study. Although we do not have a clear explanation for this difference, we hypothesize that this could be due to counteracting responses from the exposure to PPE according to the stage of bacterial cell growth and that yenR could act as both a repressor and activator. Thus, we could speculate that PPE might act by modulating some of those other genes through alternative gene regulatory pathways.
We then sought to determine whether treatment with PPE influenced the expression of fliA, fleB and flhDC involved in cell motility [4]. In Y. enterocolitica, these three genes are all members of the flagellar transcriptional hierar- chy, which includes the master regulator flhDC, the activa- tor fliA and a member of the flagellin structure fleB, and have been reported to be involved in biofilm formation and
pathogenesis through bacterial motility [4]. We investigated the changes in the expression of fliA, fleB and flhDC in the control and PPE-treated cells. In agreement with Truchado et al. [28], we observed that both fleB and flhDC were expressed in the control cells; however, the transcripts lev- els of both genes were down-regulated following treatment with PPE (Table 1 and Fig. 5). Previous studies have reported that mutations within flhDC completely abolished swimming motility and flagellin production, and a yenI mutant strain lacks the flagellin protein FleB and is unable to swim showing that some quorum sensing genes can regulate motility. It has been shown that a complex interplay between its quorum sensing systems modulates swimming motility by controlling the expressions of fleB and flhDC in Y. enterocolitica. We showed that PPE inhibited the produc- tion of the AHL-regulated violacein pigment in C. violaceum by disrupting quorum sensing and down-regulating the expression of fliA, fleB and flhDC, the flagellar regulatory genes, in Y. enterocolitica.
In the present study, we showed that the methanol extract obtained from pomegranate peels (Punica granatum L.) inhibited quorum sensing by interfering with the AHL activity and thus inhibited the production of violacein, swim- ming motility and biofilm formation in Y. enterocolitica with- out impairing its growth rate. These responses were found to be associated with the expression of quorum sensing (yenI and yenR) and motility genes (fliA, fleB and flhDC) in Y. enterocolitica. Therefore, PPE could potentially be devel- oped as an alternative supplement or therapeutic agent to prevent foodborne pathogen infections such as Y. entero- colitica. Further research such as toxicity analysis and in vivo testing are necessary for any real clinical applications.
Additionally, future research investigating the transcriptome will be very useful to further elucidate the mechanisms used by PPE to inhibit quorum sensing in Y. enterocolitica because our results for the gene regulation underlying quo- rum sensing in this study are not yet fully under-stood.
Acknowledgments
This research was supported by the Bio-industry Technology Development Program, Ministry of Agriculture, Food and Rural Affairs and the Korea Food Research Institute.
References
1. Adonizio AL, Downum K, Bennett BC, Mathee K. 2006. Anti-
quorum sensing activity of medicinal plants in southern Florida.
J. Ethnophamacol. 105: 427−435.
2. Al-Zoreky NS. 2009. Antimicrobial activity of pomegranate (Punica granatum L.) fruit peels. Int. J. Food Microbiol. 134:
244−248.
3. Atkinson S, Chang CY, Patrick HL, Buckley YW, Sockett RE, Cámara M, et al. 2008. Functional interplay between the Yersinia Pseudotuberculosis YpsRI and YtbRI quorum sens- ing systems modulates swimming motility by controlling expression of flhDC and fliA. Mol. Microbiol. 69: 137−151.
4. Atkinson S, Chang CY, Sockett RE, Cámara M, Williams P.
2006. Quorum sensing in Yersinia enterocolitica controls swimming and swarming motility. J. Bacteriol. 188: 1451−
1461.
5. Brackman G, Hillaert U, Van Calenbergh S, Neils HJ, Coenye T. 2009. Use of quorum sensing inhibitors to interfere with bio- film formation and development in Burkholderia multivorans and Burkholderia cenocepacia. Res. Microbiol. 160: 144−151.
6. Clinical and Laboratory Standards Institute (CLSI). 2006.
Methods for dilution antimicrobial susceptibility tests for bacte- ria that grow aerobically; Approved standard, seventh edition.
CLSI document M7-A7. Clinical and Laboratory Standards Institute, Wayne, USA.
7. Choo JH, Rukayadi Y, Hwang JK. 2006. Inhibition of bacterial quorum sensing by vanilla extract. Lett. Appl. Microbiol. 42:
637−641.
8. Dikmen M, Ozturk N, Ozturk Y. 2011. The antioxidant potency of Punica granatum L. fruit peel reduces cell proliferation and induces apoptosis on breast cancer. J. Med. Food 14: 1638−
1646.
9. Fischer UA, Carle R, Kammerer DR. 2011. Identification and quantification of phenolic compounds from pomegranate (Punica granatum L.) peel, mesocarp, aril and differently pro- duced juices by HPLC-DAD-ESI/MSn. Food Chem. 127: 807−
821.
10. Giménez-Bastida JA, Truchado P, Larrosa M, Espín JC, Tomás-Barberán FA, Allende A, et al. 2011. Urolithins, ellagi- tannin metabolites produced by colon microbiota, inhibit quo- rum sensing in Yersinia enterocolitica: phenotypic response and associated molecular change. Food Chem. 132: 1465−
1474.
11. Girennavar B, Cepeda ML, Soni KA, Vikram A, Jesudhasan P, Jayaprakasha GK, et al. 2008. Grapefruit juice and its furo- coumarins inhibits autoinducer signaling and biofilm formation in bacteria. Int. J. Food Microbiol. 125: 204−208.
12. Hardman AM, Stewart GSAB, Williams P. 1998. Quorum sensing and cell-cell communication dependent regulation of gene expression in pathogenic and non-pathogenic bacteria.
Anton. Leeuw. Int. J. G. 74: 199−210.
13. Hoffmann R, Erp K, Trűlzsch K, Heesemann J. 2004. Tran- scriptional responses of murine macrophages to infection with Yersinia enterocolitica. Cell Microbiol. 6: 377−390.
14. Kalia VC. 2012. Quorum sensing inhibitors: an overview. Bio-
technol. Adv. 31: 224−245.
15. Khan MSA, Zahin M, Hasan S, Husain FM, Ahmad I. 2009.
Inhibition of quorum sensing regulated bacterial functions by plant essential oils with special reference to clove oil. Lett.
Appl. Microbiol. 49: 354−359.
16. Koh K, Tham F. 2011. Screening of traditional Chinese medic- inal plants for quorum-sensing inhibitors activity. J. Microbiol.
Immunol. Infect. 44: 144−148.
17. Lazar V. 2011. Quorum sensing in biofilms – how to destroy the bacterial citadels or their cohesion/power? Anaerobe 17:
280−285.
18. Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2-∆∆CT method. Methods 25: 402−408.
19. Madrigal-Carballo S, Rodriguez G, Krueger GG, Dreher M, Reed JD. 2009. Pomegranate (Punica granatum) supple- ments: Authenticity, antioxidant and polyphenol composition.
J. Funct. Foods 1: 324−329.
20. Negi PS, Jayaprakasha GK. 2006. Antioxidant and antibacte- rial activities of Punica granatum peel extracts. J. Food Sci.
68: 1473−1477.
21. Packiavathy IASV, Palani A, Musthafa KS, Pandian SK, Ravi AV. 2012. Antibiofilm and quorum sensing inhibitory potential of Curcuma cyminum and its secondary metabolite methyl eugenol against gram negative bacterial pathogens. Food Res. Int. 45: 85−92.
22. Packiavathy IASV, Priya S, Pandian SK, Ravi AV. 2014. Inhibi- tion of biofilm development of uropthogens by curcumin-An anti-quorum sensing agent from Curcuma longa. Food Chem.
148: 453−460.
23. Panichayupakaranant P, Tewtrakull S, Yuenyongsawasd S.
2010. Antibacterial, anti-inflammatory and anti-allergic activi- ties of standardised pomegranate rind extract. Food Chem.
123: 400−403.
24. Pratt LA, Kolter R. 1998. Genetic analysis of Escherichia coli biofilm formation: roles of flagella, motility, cheotaxis and type I pili. Mol. Microbiol. 30: 285−293.
25. Swift S, Downie JA, Whitehead NA, Barnard AML, Almond GPC, Williams P. 2001. Quorum sensing as a population den- sity-dependent determinant of bacterial physiology. Adv.
Microbial. Physiol. 45: 199−270.
26. Throup JP, Camara M, Briggs GS, Winson MK, Chhabra SR, Bycroft BW, et al. 1995. Characterisation of the yenI/yenR locus from Yersinia enterocolitica mediating the synthesis of two N-acylhomoserine lactone signal molecules. Mol. Micro- biol. 17: 345−356.
27. Truchado P, Gil A, Tomás-Barberán FA, Allende A. 2009. Inhi- bition by chestnut honey of N-acyl-L-homoserine lactones and biofilm formation in Erwinia carotovora, Yersinia enterocolitica, and Aeromonas hydrophila. J. Agric. Food Chem. 57: 11186−
11193.
28. Truchado P, Giménez-Bastida JA, Larrosa M, Castro-Ibánez I, Espín JC, Tomás-Barberán FA, et al. 2012. Inhibition of quo-
rum sensing (QS) in Yersinia enterocolitica by an orange extract rich in glycosylate flavanones. J. Agric. Food Chem.
60: 8885−8894.
29. Vattem DA, Mihalik K, Crixell SH, McLean RJC. 2007. Dietary phytochemicals as quorum sensing inhibitors. Fitoterapia 78:
302−310.
30. Young GM. 2004. Flagella: orangelles for motility and protein secretion. In Yersinia: molecular and cellular biology. ed Car- niel E, Hinnebusch BJ pp.243−256. Wymondham, United
Kingdom: Horizon bioscience.
31. Zhang J, Rui X, Wang L, Guan Y, Sun X, Dong M. 2014. Poly- phenolic extract from Rosa rugosa tea inhibits bacterial quo- rum sensing and biofilm formation. Food Contr. 42: 125−131.
32. Zhao X, Yuan Z, Fang Y, Yin Y, Feng L. 2013. Characteriza- tion and evaluation of major anthocyanins in pomegranate (Punica granatum L.) peel of different cultivars and their development phases. Eur. Food Res. Technol. 236: 109−117.
국문초록
석류껍질추출물이식중독균여시니아엔테로콜리티카의쿼럼센싱과바이오필름형성능억제
오수경1, 장현주2, 전향숙3, 김현진4, 이나리1*
1한국식품연구원장내미생물연구단
2한국식품연구원식품안전연구단
3중앙대학교식품공학부
4경상대학교응용생명과학부(BK21 plus) 식품공학과
쿼럼센싱은세포간의의사소통방법이며박테리아의병원성과관련된유전자들의조절메커니즘이다. 박테리아는다양한생리학적 과정들을제어하기위해이쿼럼센싱시스템을활용한다. 본연구에서석류(Punica granatum L.) 껍질추출물이바이오리포터균주 인 Chromobacterium violaceum 과 C. violaceum CV026에서쿼럼센싱억제능을갖는것으로 1차선별되어식중독균인 Y. enterocolitica 에서편모에의한운동능과바이오필름형성억제능에대한석류껍질추출물의효과에대한다음실험을수행하였다. 추가로 N- acylhomoserine lactones (AHLs)의합성(yenI and yenR)과편모레귤론(fliA, fleB and flhDC) 에관련된특정유전자의발현변화를역 전사중합효소연쇄반응법으로평가하였다. 결과는석류껍질추출물이 C. violaceum CV026에서쿼럼센싱으로제어되는바이오레신 생산을 78.5%까지억제하였으며, Y. enterocolitica에서는세포의성장에영향을주지않고바이오필름형성과편모운동성을현저히 감소시키는것을확인할수있었다. 이러한억제효과는 AHLs의합성과운동성에관여하는유전자발현을 down-regulation 하는결과 와도일치하였다. 본연구의결과는석류껍질추출물의임상적용을위하여생체내특성에대한추가적인연구가필요하다는것뿐 아니라석류껍질추출물이사람의위장관염을방지하기위한잠재적인치료제가될수있다는것을보여준다.