• 검색 결과가 없습니다.

Association of Polymorphisms in the Vitamin D Receptor Promoter with Idiopathic Short Stature

N/A
N/A
Protected

Academic year: 2021

Share "Association of Polymorphisms in the Vitamin D Receptor Promoter with Idiopathic Short Stature"

Copied!
5
0
0

로드 중.... (전체 텍스트 보기)

전체 글

Loading

수치

Table 1. Primer set and Tm for the SNaPshot assay VDR (rs11568820): 60˚C Forward: ggaaggaaaagaggatagaga Reverse: cttttcagtttgttcccttg SNP Primer: tattcctgagtaaactaggtcaca VDR (rs4516035): 60˚C Forward: agctgtctcagaaatggttc Reverse: atctgctagaggacaggtga SNP
Table 4. Logistic analysis of VDR polymorphism

참조

관련 문서

HPLC profile of cell culture supernatant of Methylosinus JR31 (a), and effect of HPLC fractions on the growth of vitamin-requiring Methylomonas JR29...

Objective: This study was conducted to identify the association between vitamin D and osteosarcopenia among all adults in Korea using data from the Korea National Health

Factors associated with hypertension control in Korean adults: The fifth Korea National Health and Nutrition Examination Survey (KNHANES V-2).. Association of stress

Effect of caloric restriction on the expression of PGC-1 and PPARs mRNA in liver of Otsuka Long-Evans Tokushima Fatty Rats.. Long-lived growth hormone

Objective: This study was conducted to identify the association between vitamin D and Sarcopenia among all adults in Korea using data from the National Health and

Objectives: The aim of this study was to study the relationship between smoking, alcohol drinking and vitamin D level among Korean adults using data from the

Effects of combined calcium and vitamin D supplementation on insulin secretion, insulin sensitivity and β -cell function in multi-ethnic vitamin D-deficient

Above all, I think it is desirable that national assembly resolves the problems of the privilege of speech for itself by strengthening stature and function of