Article: Microbiology
Cytochrome P450 and the glycosyltransferase genes are necessary for product release from epipyrone polyketide synthase in Epicoccum nigrum
Eun Ha Choi1 · Si-Hyung Park2 · Hyung-Jin Kwon1
Received: 17 June 2021 / Accepted: 15 July 2021 / Published Online: 30 September 2021
© The Korean Society for Applied Biological Chemistry 2021
Abstract The epipyrone (EPN) biosynthetic gene cluster of Epicoccum nigrum is composed of epnC, epnB, and epnA, which encode cytochrome P450 oxidase, glycosyltransferase, and highly reducing polyketide synthase, respectively. Gene inactivation mutants for epnA, epnB, and epnC were previously generated, and it was found that all of them were incapable of producing EPN and any of its related compounds. It was also reported that epnB inactivation abolished epnA transcription, generating ΔepnAB.
This study shows that the introduction of native epnC readily restored EPN production in ΔepnC, suggesting that epnC is essential for polyketide release from EpnA and implies that EpnC works during the polyketide chain assembly of EpnA. Introduction of epnC promoter-epnA restored EPN production in ΔepnA. The ΔepnB genotype was prepared by introducing the epnA expression vector into ΔepnAB, and it was found that the resulting recombinant strain did not produce any EPN-related compounds.
A canonical epnB inactivation strain was also generated by deleting its 5′-end. At the deletion point, an Aspergllus nidulans gpdA promoter was inserted to ensure the transcription of epnA, which is located downstream of epnB. Examination of the metabolite profile of the resulting ΔepnB mutant via LC-mass spectrometry verified that no EPN-related compound was produced in this strain. This substantiates that C-glycosylation by EpnB is a prerequisite for the release of EpnA-tethered product. In conclusion, it is proposed that cytochrome P450 oxidase and glycosyltransferase work in concert with polyketide synthase to
generate EPN without the occurrence of any free intermediates.
Keywords Biosynthetic gene · Epicoccum nigrum · Epipyrone · Gene expression · Gene inactivation
Introduction
Epipyrone A (EPN), also known as orevactaene, is a product of Epicoccum nigrum and co-occurs with minor structural isomers, including epipyrone B and C [1,2]. In addition to its general antimicrobial activity [1], several interesting biological activities have been found for EPN [2-5]. EPN contains a conjugated heptaene chain connected to an α-pyrone moiety with C-D- galactosylation [6] (Fig. 1A). The other end of the linear carbon chain of EPN contains a saturated hydrocarbon chain with four alkyl branches, three of which are three methyl and the other one is a carboxylic group. These structural features support the polyketide origin of EPN.
Polyketide biosynthesis is mediated by polyketide synthase (PKS), which assembles acetate units to generate a carbon skeleton, identical to that of fatty acid synthase, except that various α- modified acetate units can be adopted though PKS [7]. PKS systems can be categorized into non-reducing (aromatic) and reducing types [8,9]. The former generates a poly β-ketone chain, which is cyclized to an aromatic structure. The reducing-type PKS is generally a multidomain polypeptide where the β-oxo group is reductively modified, partially or fully, through the activities of β- ketoacyl-ACP reductase, β-hydroxy acyl-ACP dehydratase, and trans-2-enoyl-ACP reductase domains. The highly reducing type (HR) of fungal PKS (fPKS) harbors the full catalytic potential to reduce β-oxo into a methylene group, with one set of domains working iteratively. The work of HR-fPKS is special in that the degree of β-oxo modification differs with each acetate unit incorporation [10,11]. The iterative catalysis of each HR-fPKS operates in its own permutation program, which is a major source of structural diversity in the reduced fungal polyketides. Many Hyung-Jin Kwon ()
E-mail: [email protected]
1Department of Biological Sciences and Bioinformatics, Myongji University, Yongin-si, Gyeonggi-do 17058, Republic of Korea
2Department of Oriental Medicine Resources and Institute for Traditional Korean Medicine Industry, Mokpo National University, Muan-gun, Jeollanam-do 58554, Republic of Korea
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.
org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
HR-fPKSs also harbor a C-methyltransferase domain, and its α- methylation activity is also programmed to work on specific rounds of acetate unit condensation during chain assembly.
Prior knowledge of the HR-fPKS mechanism prompted us to propose the biosynthetic mechanism of EPN (Fig. 1A). It should be noted that the proposed biosynthetic mechanism has been revised based on the knowledge obtained in this study. The hypothetical EPN biosynthetic gene cluster was localized in the E.
nigrum genome sequence after searching for an HR-fPKS gene that is clustered with a glycosyltransferase gene [12]. This led to the identification of the gene cluster, which is composed of the genes encoding HR-PKS (EpnA), a glycosyltransferase (EpnB), a cytochrome P450 oxidase (EpnC), and a transporter (EpnD) (Fig.
1B). It has been proposed that EpnC converts a methyl group (the
C28 position in EPN) to a carboxylic group through a three-step oxidation process, while EpnB incorporates D-galactose into the pyrone moiety (Fig. 1A). Separate targeted gene inactivation of epnA, epnB, and epnC abolished EPN production, indicating that EpnABC is involved in EPN biosynthesis [12].
In this study, gene expressions in the previously established gene inactivation mutants were performed to confirm that E.
nigrum is incapable of producing any EPN-related compounds when either epnB or epnC is lost. An additional mutant of epnB inactivation was also generated and analyzed, and it was found that it did not produce any EPN-related compounds, either. This supports the hypothesis that D-galatosylation is required for product release during EPN biosynthesis. This study also provides a reliable gene expression method for E. nigrum, including the Fig. 1 The proposed biosynthetic pathway of epipyrone A (EPN) (A) and the genetic organization of the EPN biosynthetic gene cluster (B). (A) The PKS domain abbreviations are: KS, β-ketoacyl-ACP synthase; AT, acyltransferase; DH, β-hydroxyacyl-ACP dehydratase; cMT, C-methyltransferase;
ER, trans-2-enoyl-ACP reductase; KR, β-ketoacyl-ACP reductase; ACP, acyl carrier protein. SAM stands for S-adenosyl-L-methionine. Acetate units and SAM-derived carbons are denoted with bars and black dots, respectively. (B) The epnABCD genes are shown with their locus tag numbers (NCBI GenBank database accession no. KZ107846.1). The regions used in preparing the expression vectors are shown in bars below the genetic map with the cognate vector names. The regions deleted in the gene inactivation mutants (ΔepnC, ΔepnAB, and ΔepnA) are also indicated with dotted lines
introduction of a suitable promoter.
Materials and Methods
Culture conditions, transformation procedure, extraction methods, and analytical procedures
Epicoccum nigrum KACC (Korean Agricultural Culture Collection) 40642 was used in this study. Wild-type (WT) E.
nigrum and its derivatives were grown on potato dextrose agar (PDA; Bacto, Sparks, MD, USA) at 25oC for 7 d. Vector introduction into E. nigrum was achieved using the Agrobacteirum transformation technique [13]. Minor modifications of this procedure were performed as described previously [12].
Agar blocks of the PDA culture were used to inoculate Czapek Dox media (Oxoid, Basingstoke, UK) composed of 0.2% NaNO3, 0.05% KCl, 0.05% magnesium glycerophosphate, 0.001% FeSO4, 0.035% K2SO4, and 3% sucrose. The Czapek Dox liquid culture was prepared in a 50 mL volume in a 250-mL baffled flask with 3 pieces of 1-cm diameter agar blocks. The liquid cultures were maintained at 25 oC for 7 d with a shaking speed of 250 rpm. The PDA solid culture was submerged in the same volume of methanol for extraction. From the liquid culture, the cell mass was separated from the supernatant via centrifugation and extracted with methanol. The supernatant was then extracted with ethyl acetate or n-butanol. The organic extracts were concentrated under reduced pressure and dissolved in methanol for chemical analysis.
Thin layer chromatography (TLC) was performed on silica gel 60 F254 TLC plates (Merck, Darmstadt, Germany), which were developed with n-butanol/acetic acid/water (12:3:5, by vol.).
High-performance liquid chromatography (HPLC) analysis was performed on a Prostar system (Varian, Palo Alto, CA, USA) with a Gemini C18 column (150×3.0 mm, particle size of 5 μm, pore size of 11 nm; Phenomenex, Torrance, CA, USA), and the elution was monitored at 330 nm. The mobile phase consisted of 0.1%
formic acid in water (A) and 0.1% formic acid in acetonitrile (B).
The flow rate was maintained at 0.5 mL/min. The system was run with the following gradient program: 100% A for 5 min, 100%- 80% A over 10 min, 80% A-100% B over 10 min, and then maintained at 100% B for 10 min. Liquid chromatography (LC)- mass spectrometry (MS) analysis was performed using a Dionex UltiMate 3000 UHPLC (Thermo Scientific, Sunnyvale, CA, USA) combined with an LTQ XL Orbitrap mass spectrometer (Thermo Scientific, Bremen, Germany) on a reverse-phase Kinetex column (100 mm×2.1 mm, particle size of 1.7 μm, pore size of 10 nm; Phenomenex), which was maintained at 40oC. The flow rate was maintained at 0.2 mL/min. Gradient elution was performed using a mobile phase composed of 0.1% formic acid in water (A) and 0.1% formic acid in acetonitrile (B). Gradient elution was applied using the following program: 90%-50% A over 20 min, 50% A-100% B over 10 min, and then maintained at 100% B for 10 min. Electrospray ionization mass spectra in
positive mode were obtained in Fourier-transform mode with a resolution of R =30,000 at m/z 400. Metabolites were detected via full-scan mass analysis from m/z values of 300 to 1,000.
Preparation of gene expression constructs
The primers used in this study are listed in Table 1. Herculase II fusion DNA polymerase (Agilent, Santa Clara, CA, USA) was used for polymerase chain reaction (PCR) and cloning experiments were performed using In-Fusion cloning method (Clontech, Mountain View, CA, USA). The gene expression constructs were prepared in pUR5750, which harbors a hygromycin resistance cassette [14]. The E. nigrum transformants of pUR5750 and its derivatives were selected using 100 μg/mL hygromycin (Duchefa Biochemie, Haarlem, Netherlands).
The epnC expression constructs, pEH_epnC1 and pEH_epnC2, were prepared by cloning epnC and its native 5′- and 3′-UTRs (untranslated regions); pEH_epnC1 and pEH_epnC2 differ only in the length of the 5′-UTR, harboring 0.9 kb and 1.5 kb of the 5′- UTR, respectively (Fig. 1B). Both contain 1.0 kb of the 3′-UTR, which corresponds to the intergenic region between epnC and epnB. The inserts were amplified from the total DNA of E.
nigrum by using the 5′ primers EH-C-F-1 and EH-C-F-2 for pEH_epnC1 and pEH_epnC2, respectively, and the 3′ primer EH- C-R. The PCR products were cloned into the HindIII site of pUR5750.
The epnA expression construct pEH_epnA was prepared by cloning epnA with its native 5′- and 3′-UTRs. Because epnA is 7.9 kb long, cloning was performed using two fragments. First, 4.9 kb of the 3′-region, which includes 1.0 kb of the 3′-UTR, was amplified with the primer pair EH-A-dw-F/-R. In primer EH-A- dw-F, a PacI site was introduced for further cloning. The 4.9 kb PCR product was cloned into the HindIII site of pUR5750. Into the PacI site of the resulting construct, 5.0 kb of the 5′-region, including 0.9-kb 5′-UTR, was inserted (this 5′-UTR includes 0.5 kb of the 3′-region of epnB) (Fig. 1B). This 5′-regin of epnA was amplified with the primer pair EH-A-up-F/-R. The EH-A-up-R primer was designed to eliminate the PacI site at the recombination point in the final construct, pEH_epnA. For the following cloning step, a new PacI site was introduced at the 5′-end of the insert in pEH_epnA using the EH-A-up-F primer. To ensure the expression of epnA, the 5′-UTR of epnC (epnC promoter, epnCp) in pEH_epnC1 was cloned into the unique PacI site (upstream of epnA) of pEH_epnA, generating pEH_epnCp-epnA. The epnCp fragment was amplified using the primer pair EH-C-F-1 and EH- Cp-R. The EH-Cp-R primer was designed to eliminate the PacI site in pEH_epnCp-epnA.
The expression construct of epnB was used for gene complementation of the epnB-inactivation strain of EH-ΔepnB.
The two expression constructs, pEH_epnB1 and pEH_epnB2, differ in the length of the 5′-UTR which were designed to include 1.0 and 1.7 kb, respectively. The 5′-UTR of pEH_epnB1 corresponds to the intergenic region between epnC and epnB while the 5′-UTR
of pEH_epnB2 also includes 0.6 kb of the 3′-region of epnC. The 5′ primers used for pEH_epnB1 and _epnB2 were EH-B-F-1 and EH-B-F-2, respectively. The 3′ primer EH-B-R was designed to include the intergenic region between epnB and epnA (Fig. 1B).
Each PCR product was cloned into the HindIII site of pUR5750.
Targeted inactivation of epnB and its genotyping
An epnB-inactivation mutant (EH-ΔepnB) was generated using pEH-dB. The genetic map of this inactivation scheme is described in the Result section in Fig. 6A. In the generation of pEH-dB, two 3.0-kb regions flanking the region to be deleted were amplified and cloned to flank a selection marker. The fragments located at the 5′ and 3′ regions of epnB are named up-fragment and down- fragment, respectively. The up- and down-fragments were amplified using primer pairs of EH-dB-up-F/-R and EH-dB-dw-F/
-R, respectively. The two fragments were recombined and cloned into the plasmid pCambia 1300 (GenBank accession no.
AF234296.1), which was linearized via EcoRI and HindIII digestion. The primers used in this cloning step were designed to generate a PacI site at the recombination point of the two PCR fragment with a deletion of 192 bp in the 5′-region of epnB. Into the PacI site of the resulting construct, the neomycin resistance cassette (nptII, the bacterial neomycin phosphotransferase gene is flanked with the promoter and terminator sequence of the Aspergillus nidulans trpC gene) and the A. nidulans gpdA promoter (gpdAp) were inserted, generating pEH-dB. The nptII- gpdAp fragment was amplified from pJWS1 [15] using the primer pair EH-dB-IN-n/-g. This cloning procedure was designed so as not to retain the PacI site. The transformants that contained nptII were selected for their resistance to 100 μg/mL G-418 (Duchefa), an aminoglycoside antibiotic compound that is readily modified by neomycin phosphotransferase. The hygromycin resistance cassette in pCambia 1300 is not functional in filamentous fungi.
Two transformants were randomly selected and genotyped via Table 1 Primers used in this study. The sequences introduced for homologous recombination cloning are underlined and the restriction enzyme sites are italicized. The E. nigrum DNA sequence information was retrieved from the NCBI GenBank database (accession no. KZ107846.1). The nucleotide sequence in the database is reverse-complementary for the epnABC genes
Name Sequence (5' → 3')
EH-C-F-1 ACCATGATTACGCCAAGCTTGATGCTGCTGTGAATGTCAC
EH-C-F-2 ACCATGATTACGCCAAGCTTTTTTTCAGAAGCCGAGTCGG
EH-C-R ACCTGCAGGCATGCAAGCTTTGTTGGCGCTTTGATAGGGC
EH-A-dw-F ACCATGATTACGCCAAGCTTTTAATTAAAAGAACGATCCTTTCCAGGC
EH-A-dw-R ACCTGCAGGCATGCAAGCTTGTCACTGTAAATTAGCCATC
EH-A-up-F ACCATGATTACGCCAAGCTT TTAATTAACAACGAGCCATTCTAGAACA
EH-A-up-R GCCTGGAAAGGATCGTTCTT
EH-Cp-R TGTTCTAGAATGGCTCGTTGTCTGTTTTGTTCGAAAAGGA
EH-dB-up-F CGACGGCCAGTGCCAAGCTTGCAAGCAGCGTATTATCTCA
EH-dB-up-R TTAATTAAATTGTTGGCGCTTTGATAGG
EH-dB-dw-F AGCGCCAACAATTTAATTAACCCTTGCTGGAAACGAGGGG
EH-dB-dw-R ATGACCATGATTACGAATTCACGCTGATGCCTCCAAGGGA
EH-dB-IN-n ATCAAAGCGCCAACAATTTAGGATTACCTCTAAACAAGTG
EH-dB-IN-g CGTTTCCAGCAAGGGTTAATGTAGCTGTTAGTCAAGCTGC
EH-B-F-1 ACCATGATTACGCCAAGCTTATGACTTTGGTCAGATACCG
EH-B-F-2 ACCATGATTACGCCAAGCTTCGAGCTGTTAGAGGCAATAC
EH-B-R ACCTGCAGGCATGCAAGCTTAAGTGGTTATGACGATGTAA
EH-epnA-TSS-RT TGAGGAAGTGCAGTTTGGAC
EH-epnA-TSS-s GTATGGCTTTAGAATGCACA
EH-epnA-TSS-c AGGCATCACTGGTTCATCTG
EH-epnA-F CGATTAACACTCGAGGTGCT
EH-epnA-R ACGGATTTTGTGAGCGAAGC
EH-epnB-F TGCATCCAATCACTGCCATC
EH-epnB-R GCTTGTCGGCATCTGACTGT
EH-dB-up-check CATGAAGGATTACTCCGTCT
EH-dB-check-npt AATATGTAACCATGGTTGCT
EH-dB-dw-check TGAGCGGAGCCAGGCCAGAG
EH-dB-check-gpdAp CCCCTAAGTAAGTACTTTGC
PCR analysis. Recombination at the upstream region of epnB was examined using the primer pair EH-dB-up-check and EH-dB- check-npt. The EH-dB-up-check primer aligns to the position 130 bp upstream of that for EH-dB-up-F. The other primer EH-dB- check-npt aligns to the downstream end of nptII (at the 3′-region of trpC terminator). Recombination at the other position of epnB was examined using the primer pair EH-dB-dw-check and EH- dB-check-gpdAp. The EH-dB-dw-check primer aligns 110 bp downstream of that for EH-dB-dw-R. The other primer EH-dB- check-gpdAp aligns to the downstream end of gpdAp. The positions for the primers EH-dB-up-check and EH-dB-dw-check were not included in pEH-dB. DNA amplification using these two primer pairs is supposed to yield 3.2-kb fragments only upon the recombination between pEH-dB and the E. nigrum chromosome.
Identification of the transcription start site of epnA and reverse transcriptase-PCR analysis
For total RNA preparation, E. nigrum WT and its derivatives were grown on Hybond-N+ filters that were placed on PDA media at 25oC for 7 days. These agar cultures were initiated by spreading conidiospores. The cell mass was scraped off the filter and subjected to total RNA isolation using a Direct-zol RNA miniprep kit (Zymo Research, Irvine, CA, USA) and TRI reagent that was purchased from Sigma-Aldrich Korea (Seoul, Republic of Korea).
The primers used for the RNA experiments are listed in Table 1.
Nucleotide numbering starts at the A of the translation start codon in the mRNA sequence unless otherwise specified.
To identify the transcription start site (TSS) of the epnA monocistronic transcript, reverse transcription (RT) was conducted using SuperScript IV first-strand synthesis kit (Invitrogen, Carlsbad, CA, USA) using the EH-epnA-TSS-RT primer and 0.5 μg total RNA obtained from the WT strain. The EH-epnA-TSS- RT primer was 5′-phsophorylated and complementary with the (+)701 to (+)682 positions of epnA. The RT reaction sample was treated with RNase H (Enzynomics, Daejeon, Republic of Korea) and used for PCR amplification. The PCR reactions were performed using 2× TOPsimple premix with nTaq polymerase (Enzynomics). The PCR primer pair used was composed of EH- epnA-TSS-s [(+)320 to (+)339] and EH-epnA-TSS-c [(+)48 to (+)29]. Electrophoretic separation of the PCR reaction revealed a vivid band at 0.5 kb. The DNA band was purified and cloned into the pMD20 T-vector (Takara Korea Bio, Seoul, Republic of Korea) and subjected to nucleotide sequence determination.
RT-PCR analysis of epnA and epnB was performed from total complementary DNA (cDNA) prepared using SuperScript IV VILO master mix with ezDNase kit (Invitrogen) from 0.5 μg total RNA. The total cDNA samples were processed via PCR amplification, as described above. The primer pair (EH-epnA-F/- R) that was used for the epnA transcript was designed to amplify a 0.9-kb region whose 5′-end corresponds to (+)209. The presence of two introns made this PCR reaction amplify a 1.0-kb signal from the chromosome DNA. The primer pair (EH-epnB-F/-R)
that was used for the epnB transcript was designed to amplify a 0.6-kb region whose 5′-end corresponds to (−)88. The presence of two introns made this PCR reaction amplify a 0.7-kb signal from the chromosome DNA.
Results and Discussion
Introduction of epnC restored EPN production in ΔepnC The majority of cytochrome P450 during polyketide biosynthesis works on free polyketide intermediates, but some members have been implicated in modifying PKS-bound (tethered on the ACP domain) intermediates [15]. The absence of any related intermediate in the epnC-inactivation mutant (ΔepnC) suggested that EpnC oxidase operates on an EpnA-bound growing polyketide intermediate(s) [12]. Because the biochemical characterization of EpnC is not within the scope of this study, we aimed to verify that epnC is solely inactivated in ΔepnC through a gene complementation experiment.
Gene complementation of ΔepnC was achieved by introducing the epnC gene in pUR5750, which is the fungal version of the T- DNA vector and is supposed to randomly integrate into the host genome [14]. Two versions of the epnC expression constructs (pEH_epnC1 and _epnC2) were prepared, differing in the length of the 5′-UTR; one harboring a 0.9-kb fragment and the other harboring a 1.5-kb fragment (Fig. 1B). epnC and epnD are divergently arranged and their intergenic region is 0.5 kb in length. Both constructs contain the 1.0 kb 3′-UTR sequence that corresponds to the intergenic region between epnB and epnC.
TLC and HPLC analyses indicated that both pEH_epnC1 and epnC2 readily restored EPN production in ΔepnC (Fig. 2A, 2B).
This indicates that ΔepnC harbors no genetic defect other than the loss of epnC. Together with the previous finding that ΔepnC produced no EPN-related compounds [12], this gene complementation experiment supports the hypothesis that EpnC-mediated methyl oxidation occurs during the chain assembly by EpnA, EPN-HR- fPKS.
Three transformants with either pEH_epnC1 or _epnC2 were initially tested for EPN production via TLC analysis, and all of them displayed EPN production to a level comparable to that of the WT (data not shown). Considering that gene expression in this context involves a random chromosome integration of the T-DNA vector, the robust gene complementation observed indicates that the 5′-UTR of epnC as short as 0.9 kb is a robust promoter that can be employed in E. nigrum genetic engineering.
Transcription start site of monocistronic epnA
It was originally hypothesized that the polyketide product of EpnA is subject to post-PKS modifications via D-galactosylation by EpnB and that an EPN biosynthetic intermediate accumulates when epnB is inactivated. The α-pyrone formation that is supposed to occur at the end of EpnA catalysis (Fig. 1A) is a well-
known non-enzymatic product release mechanism in polyketide biosynthesis [16-18]. However, inactivation of epnB failed to reveal any biosynthetic intermediates of EPN [12]. Subsequent transcription analysis revealed that epnA transcription was abolished in the epnB-inactivation strain and substantiated the bicistronic transcription of epnB-epnA [12]. To make its genotype clear, this epnB-inactivation strain was named ΔepnAB in this study.
Bicistronic transcription of epnB-epnA does not rule out the presence of the monocistronic epnA transcript. The majority of epnB was deleted and replaced with the neomycin resistance gene cassette (nptII) in ΔepnAB [12]. It can be hypothesized that the 3′- region of epnB is required for monocistronic epnA transcription and that epnB deletion deters the monocistronic transcription in ΔepnAB. Before generating a new inactivation mutant of epnB, the presence of monicistronic epnA transcription was assessed via transcription start site (TSS) determination in the 5′-UTR of epnA.
Nucleotide positions indicate the numbers respective to the translation start codon in the mRNA sequence, unless otherwise specified.
Total RNA from WT E. nigrum was subjected to complementary DNA (cDNA) synthesis using the 5′ phosphorylated primer complementary to the internal site of epnA [(+)700 to (+)681, (+)798 to (+)779 in DNA]. Up to this site, there are two intron segments 98 bp in total. The cDNA was ligated with the T4 RNA ligase, and the region flanking the joint position was amplified via PCR and cloned into a T-vector for nucleotide sequencing. The experimental procedure is illustrated in Fig. 3. The sequences next
Fig. 2 TLC (A) and HPLC (B) analysis of the PDA culture-methanol extracts of the WT (1) and ΔepnC transformants of pUR5750 (2), pEH_epnC1 (3), and pEH_epnC2 (4). The elution was monitored at 330 nm and shown on the same Y-scale. The positions of EPN are indicated in the chromatograms
Fig. 3 Determination of the transcription state site (TSS) of epnA. The intron positions are indicated by the gaps and the PCR primers are shown in arrows in the epnA map, below which the hypothetical transcript and cDNA regions are shown. Ligation created a bond between the 5′- and 3′- terminal of the cDNA. The former and the latter corresponds to the 5′- end cDNA synthesis primer and the TSS. The nucleotide sequences obtained from the two clones are shown; the cDNA synthesis primer sequences are italicized and underlined. TSS determination results are summarized in the bottom of the figure
Fig. 4 TLC (A) and HPLC (B) analysis of the PDA culture-methanol extracts of the epnA expression transformants. The strains presented are the WT (1), ΔepnA (2), ΔepnAB (3), and the ΔepnA and ΔepnAB transformants with pEH_epnCp:epnA (4 and 6, respectively) and pEH_epnA (5 and 7, respectively). The elution was monitored at 330 nm and shown on the same Y-scale. The positions of EPN are indicated in the chromatograms
Fig. 5 TLC (A) and HPLC (B) analysis of the supernatant-butanol extracts obtained from Czapek Dox liquid cultures of the epnA expression transformants. The strains presented are the WT (1), ΔepnA (2), ΔepnAB (3), and the ΔepnA and ΔepnAB transformants with pEH_epnCp:epnA (4 and 6, respectively) and pEH_epnA (5 and 7, respectively). (C) Half the amount of the extracts that were used in (B), from the WT (1) and ΔepnA- pEH_epnCp:epnA (4), were also analyzed via HPLC to visualize their relative signal levels. The elution was monitored at 330 nm and shown on the same Y-scale. The positions of EPN are indicated in the chromatograms
to the 5′ end of the cDNA primer sequence guided us to localize the TSS at the (−)83 or (−)86 position. The nucleotide sequences of the two clones showed that they did not harbor any intron sequence. Inaccurate nucleotide incorporation during transcription initiation gives rise to the 5′ heterogeneity of mRNAs [19]. The 5′
sequences deduced from the two PCR clones have a few nucleotide differences in length and have mismatched nucleotides incorporated (Fig. 3). The determination of the monocistronic epnA TSS, together with the previous report regarding the bicistronic transcript of epnB-epnA [12], substantiates that epnA is transcribed from two distinctive promoters.
Expression of epnA in ΔepnAB was incapable of producing any EPN-related compounds
The presence of monocistronic epnA expression prompted us to express epnA in ΔepnAB. Successful epnA expression in this strain results in the selective loss of epnB. To ensure fidelity, the epnA expression construct was tested for its ability to complement the epnA inactivation mutant (ΔepnA). The epnA expression construct was prepared in pUR5750 (pEH_epnA) and contains 0.9 kb and 1.1 kb of the 5′- and 3′-UTR, respectively (Fig. 1B). The 0.9-kb 5′-UTR includes 0.5 kb of the 3′-region of epnB. To ensure epnA transcription, the 0.9-kb 5′-UTR of epnC (epnCp) that was used in pEH_epnC2 was inserted into pEH_epnA upstream of
epnA to generate pEH_epnCp-epnA. pEH_epnCp-epnA, but not pEH_epnA, partially restored EPN production in ΔepnA (Fig. 4).
ΔepnAB transformed with pEH_epnCp-epnA or pEH_epnA showed no sign of EPN-related compounds that are supposed to have the same characteristic color as EPN. The ΔepnAB transformants displayed a smearing pattern in TLC separation (Fig. 4A) as well as the augmentation of peaks other than EPN in the HPLC traces (Fig. 4B), so this deemed not be a sign of EPN- related compounds.
The transformants were also cultivated in Czapek Dox liquid medium, and the organic extracts were analyzed. As judged from the WT strain, butanol was more efficient than ethyl acetate in obtaining EPN from the culture supernatant (data not shown). The methanol extract of the cell pellet also contained EPN as found during HPLC analysis, but the content was not sufficient for visual detection in TLC analysis (data not shown). As found in the butanol extract, pEH_epnA, in addition to pEH_epnCp-epnA, readily restored EPN production in ΔepnA (Fig. 5). TLC and HPLC analysis showed no sign of EPN-related compounds in the ΔepnAB transformants harboring the epnA expression. The restoration of EPN by pEH_epnA in ΔepnA indicates that epnA is expressed from its own promoter, but its expression is highly dependent on the culture environment.
Fig. 6 Gene inactivation of epnB for the generation of EH-ΔepnB. (A) Gene inactivation scheme with the genetic map of epnB and its surrounding regions. The sizes of DNA fragments used in the inactivation plasmid (pEH-dB) and that of the deleted region in epnB are shown in kb. The regions of EH-ΔepnB DNA that were targeted for PCR amplification are shown in bars above the genetic map. PCR analysis of the WT (1) and two EH-ΔepnB strains (2 and 3) performed using EH-dB-up-check and EH-dB-check-npt (B) or EH-dB-dw-check and EH-dB-check-gpdAp (C). Lane M indicates the DNA size marker that is composed of 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.5, 2.0, 2.5, 3.0, 4.0, 5.0, 6.0, 8.0, and 10.0 kb fragment. The positions of the 1.5- and 3.0-kb fragments are indicated with bars at the left side. Nucleotide sequence determination verified the identity of the PCR fragments
Inactivation of epnB resulted in the complete loss of the EPN pathway
Results of the epnA expression studies in ΔepnAB implied that EpnB catalysis is involved in the polyketide chain release from EpnA, the EPN-HR-fPKS. To support this idea, we attempted to selectively inactivate epnB to analyze its capacity to produce EPN-related compound. To generate a new epnB inactivation mutant (EH-ΔepnB), the epnB inactivation construct pEH-dB was prepared by deleting the 0.2-kb fragment in the 5′-region of epnB
and inserting nptII and A. nidulans gpdA promoter (gpdAp) into the deleted region (Fig. 6A). The gpdAp was positioned in the direction of epnA to ensure its transcription. Two pEH-dB transformants were subjected to genotype verification via PCR amplification. The primer pairs were designed to amplify the sequences that were predicted to exist in EH-ΔepnB, but not in the WT or pEH-dB (Fig. 6A). One primer corresponds to the sequences outside of the 3.0-kb fragments in pEH-dB in the genome and the other to the 3′-end of nptII or gpdAp. PCR amplification successfully amplified 3.2-kb fragments at both recombination points for pEH-dB integration in the two EH-ΔepnB mutant strains, but not in the WT (Fig. 6BC). We first examined whether epnA transcription was not deterred in EH-ΔepnB because the main purpose of this gene inactivation experiment was to compensate for the drawback of the previous epnB inactivation (ΔepnAB) that blocked epnA expression [12]. cDNA samples were subjected to PCR amplification of the epnA or epnB fragments. Each PCR primer pair was designed to amplify the 5′- region of the target mRNA and include introns. Results demonstrated that epnA transcription was retained, while that of epnB was below the detection level in EH-ΔepnB (Fig. 7). We also noted that intron retention can occur during transcription, as we found in a previous study [12].
To provide in vivo proof that epnB is selectively inactivated in EH-ΔepnB, a gene complementation study was conducted. Two versions of the epnB expression constructs were prepared. The 5′- UTR of pEH_epnB1 and pEH_epnB2 are 1.0 kb and 1.7 kb long, respectively (Fig. 1B), where the former corresponds to the intergenic region between epnC and epnB. The 1.7-kb 5′-UTR also includes 0.7 kb of the 3′-region of epnC. The 3′-UTR of both constructs contain 0.4 kb of the intergenic region between epnB and epnA. EH-ΔepnB was transformed with pUR5750, pEH_epnB1, or pEH_epnB2, and four transformants for each vector were tested for EPN production. In the TLC analysis of the extracts from the PDA cultures, one of four pEH_epnB2 transformants (strain 3) produced EPN, while one pEH_epnB1 transformant (strain 4) Fig. 7 PCR analysis of epnA and epnB with WT DNA (1) and cDNAs
obtained from the WT (2), ΔepnA (3), and two of the EH-ΔepnB strains (4 and 5). The target gene names are shown at the left of each gel picture, and the PCR primer design is described in the Materials and Methods section. Lane M indicates the DNA size marker that is composed of 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.5, 2.0, 2.5, 3.0, 4.0, 5.0, 6.0, 8.0, and 10.0 kb fragment. The positions of the 0.5-, 1.0-, and 1.5-kb fragments are indicated with bars at the left side of each gel picture
Fig. 8 TLC analysis of the PDA culture-methanol extracts (A) and the supernatant-butanol extracts of Czapek Dox liquid cultures (B) of the WT and four transformants of EH-ΔepnB (designated 1 to 4) containing pUR5750, pEH-epnB1, or pEH-epnB2
Fig. 9 LC-MS analysis of the PDA culture-methanol extracts and the supernatant-butanol extracts of Czapek Dox liquid cultures of the WT (A and C, respectively) and EH-ΔepnB strains (B and D, respectively). For each sample, the total ion chromatogram (TIC), absorption trace at 260 nm (A260), and extracted ion chromatogram (EIC) were provided. The EICs are prepared at m/z values at 421, 451, 583, and 613; the m/z scanning range is ±0.5. EPN peaks are indicated with arrows in the WT TICs. The bars indicate the signals that display the m/z values of EPN
displayed a very low level of EPN (Fig. 8A). Czapek Dox liquid media culture also showed a similar pattern in restoring EPN production as that of PDA, with strain 3 of EH-ΔepnB/
pEH_epnB2 displaying higher EPN level than the WT (Fig. 8B).
The pUR5750-based gene expression system involves random vector integration into the chromosome; thus, the expression of the delivered gene can be affected by the position where it was inserted, especially when the transcription elements around the gene are not sufficient to drive independent transcription. It can be hypothesized that the 3′-UTR used in the pEH_epnB vectors (a 1.0-kb sequence of the intergenic region between epnC and epnB) is incapable of mediating transcription termination. This theory was consistent with the bicistronic transcription of epnB-epnA.
The expression of epnA was proposed to involve both monocistronic and bicistronic transcripts, but the sole source of the epnB message might be the bicistronic transcript alone. This implies that transcription termination is not sufficient for robust transcription when the intergenic region between epnC and epnB is used.
However, we could not exclude the possibility that the 5′-UTR of pEH_epnB2 is not sufficient for transcription initiation. Despite this drawback, the gene complementation results demonstrate that pEH-epnB2 is capable of restoring EPN production in EH-ΔepnB.
Thus, epnB is selectively inactivated, while epnA is fully functional in EH-ΔepnB. EH-ΔepnB is incapable of producing EPN-related compounds as judged from the pUR5750 transformants (Fig. 8AB).
To verify that EH-ΔepnB does not produce any EPN intermediates, LC-MS analysis was conducted using the extracts from the PDA and Czapek Dox liquid media cultures. For the Czapek Dox liquid cultures, the methanol extract of the cell pellet and the ethyl acetate extract of the supernatant were also analyzed but not included in this study because there was no significant feature found other than those found in the butanol extract of the supernatant. LC-MS traces of the methanol extract of the PDA cultures and the butanol extract of the supernatant from the Czapek Dox liquid cultures are shown in Fig. 9. The mass spectra were analyzed by searching m/z values for the hypothetical EPN intermediates, and the results are shown in the extracted ion chromatograms. There are two hypothetical modifications to the polyketide chain: C28 oxidation and D-galactosylation. With these two modifications, we can view three hypothetical intermediates, C28-methyl-EPN, EPN aglycone, and C28-methyl-EPN aglycone.
The expected [M+H]+ m/z values for EPN (C34H44O10), C28- methyl-EPN (C34H45O8), EPN aglycone (C23H34O5), and C28- methyl-EPN aglycone (C23H35O3) are 613.3004, 583.3263, 451.2476, and 421.2734, respectively. The traces of the WT extracts displayed EPN peaks with an m/z value of 613.300. The EPN signal displayed a smearing pattern, which was attributed to the presence of its isomers [1,2,6,12]. In EH-ΔepnB, ion signals for the selected m/z values were found at 20.2 and 30.1 min.
However, their exact m/z values are 421.317 and 582.2068, respectively, which were not relevant values in our search. Thus,
it was concluded that epnB inactivation completely blocked the formation of a free polyketide structure from the EPN pathway.
In conclusion, this genetic study on EPN biosynthesis in E.
nigrum demonstrates that three genes of epnA, epnB, and epnC are required for the generation of a polyketide structure from this PKS system. It is thus tempting to propose that EpnC (a cytochrome P450 oxidase) act on a growing polyketide chain tethered on the HR-fPKS EpnA and the EpnB-mediated C-D-galatosylation precedes the pyran ring forming chain release from EpnA. This genetic study also showcased an application of the routine fungal genetics tool to E. nigrum and provides a competent promoter segment that can be used in E. nigrum genetic engineering.
Acknowledgment This research was supported by Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education (NRF-2016R1D1A1B02009237).
References
1. van Ginkel R, Selwood AI, Wilkins AL, Ford S, Calder C (2012) Anti- microbial compositions. US Patent 20120108526A1 May 2012 2. Peng J, Jiao J, Li J, Wang W, Gu Q, Zhu T, Li D (2012) Pyronepolyene
C-glucosides with NF-κB inhibitory and anti-influenza A viral (H1N1) activities from the sponge-associated fungus Epicoccum sp. JJY40.
Bioorg Med Chem Lett 22: 3188−3190. doi: 10.1016/j.bmcl.2012.03.044 3. Shu YZ, Ye Q, Li H, Kadow KF, Hussain RA, Huang S, Gustavson DR, Lowe SE, Chang LP, Pirnik DM, Kodukula K (1997) Orevactaene, a novel binding inhibitor of HIV-1 rev protein to Rev response element (RRE) from Epicoccum nigrum WC47880. Bioorg Med Chem Lett 7:
2295−2298. doi: 10.1016/S0960-894X(97)00407-1
4. Kimura J, Furui M, Kanda M, Sugiyama M (2002) Telomerase inhibitor.
Japan Patent 2002047281A Feb 2002
5. Hufendiek P (2017) Enzyme-inhibitory secondary metabolites and their exudation in the marine-derived fungus Epicoccum nigrum link.
Dissertation, Rheinische Friedrich-Wilhelms-Universität Bonn 6. Preindl J, Schulthoff S, Wirtz C, Lingnau J, Fürstner A (2017)
Polyunsaturated C‐glycosidic 4‐hydroxy‐2‐pyrone derivatives: Total synthesis shows that putative orevactaene is likely identical with epipyrone A. Angew Chem Int Ed Engl 56: 7525−7530. doi: 10.1002/
anie.201702189
7. Hopwood DA, Sherman DH (1990) Molecular genetics of polyketides and its comparison to fatty acid biosynthesis. Ann Rev Genet 24: 37−62.
doi: 10.1146/annurev.ge.24.120190.000345
8. Staunton J, Weissman KJ (2001) Polyketide biosynthesis: a millennium review. Nat Prod Rep 18: 380−416. doi: doi.org/10.1039/A909079G 9. Hertweck C (2009) The biosynthetic logic of polyketide diversity.
Angew Chem Int Ed Engl 48: 4688−4716. doi: 10.1002/anie.200806121 10. Cox RJ (2007) Polyketides, proteins and genes in fungi: programmed nano-machines begin to reveal their secrets. Org Biomol Chem 5: 2010− 2026. doi: 10.1039/b704420h
11. Chooi YH, Tang Y (2012) Navigating the fungal polyketide chemical space: from genes to molecules. J Org Chem 77: 9933−9953. doi:
10.1021/jo301592k
12. Lim YJ, Choi EH, Park SH, Kwon HJ (2020) Genetic localization of the orevactaene/epipyrone biosynthetic gene cluster in Epicoccum nigrum.
Bioorg Med Chem Lett 30: 127242 doi:10.1016/j.bmcl.2020.127242 13. Michielse CB, Hooykaas PJ, van den Hondel CA, Ram AF (2008)
Agrobacterium-mediated transformation of the filamentous fungus Aspergillus awamori. Nat Protoc 3: 1671−1678. doi: 10.1038/nprot.2008.
154
14. de Groot MJ, Bundock P, Hooykaas PJ, Beijersbergen AG (1998) Agrobacterium tumefaciens-mediated transformation of filamentous fungi. Nat Biotechnol. 16: 839−842. doi: 10.1038/nbt0998-839 15. Greule A, Stok JE, Voss JD, Cryle M (2018). Unrivalled diversity: the
many roles and reactions of bacterial cytochromes P450 in secondary metabolism. Nat Prod Rep 35: 757−791
16. Fujii I, Yoshida N, Shimomaki S, Oikawa H, Ebizuka Y (2005) An iterative type I polyketide synthase PKSN catalyzes synthesis of the decaketide alternapyrone with regio-specific octa-methylation. Chem Biol 12: 1301−1309. doi: 10.1016/j.chembiol.2005.09.015
17. Kasahara K, Fujii I, Oikawa H, Ebizuka (2006) Expression of Alternaria solani PKSF generates a set of complex reduced‐type polyketides with different carbon‐lengths and cyclization. ChemBioChem 7: 920−924.
doi: 10.1002/cbic.200600034
18. Hashimoto M, Nonaka T, Fujii I (2014) Fungal type III polyketide synthases. Nat Prod Rep 31: 1306−1317. doi: 10.1039/c4np00096j 19. Gowda M, Li H, Wang GL (2007) Robust analysis of 5′-transcript ends:
a high-throughput protocol for characterization of sequence diversity of transcription start sites. Nat Protoc 2: 1622–1632. doi: 10.1038/nprot.
2007.242
