전신성 홍반성 루푸스 환자에서 Intravenous Vancomycin 투여로 인한 루푸스 활성기 증례 보고

Percentage of patients with portal systemic encephalopathy according to presence of small intestine

ATTGAACGCTGGCGGCATGCTTTACACATGCAAGTCGAACGGCAGCACAGAGAAGCTTGCTTCTTGGGTGGCGAGTGGCG

(A) Interestingly, this has often been the case with English animal expressions.. As you may have observed, they make irregular twists and turns in their

Accessory gene regulator group II polymorphism in methicillin-resistant Staphylococcus aureus in predictive of failure of vancomycin therapy.. Relationship of MIC and

KEY WORDS: Scanned drawing 스캔도면, Deckhouse floor outfitting 선실바닥의장, Production daily report 생산작업일보, Scanned drawing-based production

This study was conducted under the hypothesis that a group art therapy program may increase emotional expression and decrease life event stress in patients with

Results: In this research, in the group with fibromyalgia patients group, systemic lupus erythematosus patients group and without systemic autoimmune

The result of this study on the intervention of function words in children with language development delay shows that intervention of function words by grammatically