Journal of Marine Bioscience and Biotechnology 2007, p. 60-67 Vol. 2, No. 1
* Corresponding author
Phone: +84-479-110-59, Fax: +84-48-363-144 E-mail: [email protected]
Morphological and Molecular Identification of Pseudo- nitzschia sp. Strain G3 Isolated from Northern Coast of Vietnam Based on ITS Region Sequences
Diem-Hong Dang*, Hai-Quoc Luyen, Hoang Thi Minh Hien, Ngo Hoai Thu and Hoang Lan Anh Institute of Biotechnology, Vietnamese Academy of Science and Technology, Hanoi, Vietnam
Abstract For the first time in Vietnam, morphological and molecular studies of a species belong- ing to Bacillariophyceae collected in Northern coast of Vietnam are presented. Observations with microscope showed that this species belong to genus: Pseudo-nitzschia and seem like P. pungens.
Sequence data from the partial 18S small subunit ribosomal RNA gene (18S rDNA) and the internal transcribed spacer 1 – 5.8S – internal transcribed 2 have been used to determine clearly and generate a phylogenetic framework of the obtained sequences to previously reported sequences in GenBank. These results allowed us to highlight described species of Bacillariophyceae in Northern coast of Vietnam. Furthermore, accumulation of molecular study would be helpful for the identification of scientific name of harmful algal species and further taxonomic studies in Vietnam.
Key words : Pseudo-nitzschia, internal transcribed spacer 1, internal transcribed 2, 5.8S rDNA, phylogenetic analysis.
Introduction
Some microalgae produce toxins which can cause mass mortality of other marine flora and fauna includ- ing aquaculture. Algal toxins may also accumulate in shellfish or finfish, thereby posing serious human health risks upon consumption of contaminated seafood. If un- controlled, these effects may have devastating impact on the seafood industry. An improved understanding of the occurrence and distribution of the causative species, the population dynamics (growth rates, nutrient require- ments, life cycles, etc.), the ecophysiology (why and when toxic), better methodologies for detection of tox- ins and testing of toxicity, will improve our ability to forecast the events and reduce their effects, and thereby develop still better management tools. This is how we can minimize the human health and economic impacts of harmful algal events.
Although Vietnam has the great biodiversity in fresh-
water and marine microalgae, studies on harmful micro- algae in Vietnam began only a few years ago at the National Institute of Oceanography and Institute of Biotechnology belong to Vietnamese Academy of Science and Technology. In general, for harmful algal composition in Vietnamese coastal waters, a list of spe- cies including the distribution and cell density of mainly dinoflagellate (Alexandrium, Prorocentrum genera), di- atoms (Pseudo-nitzschia genus) and cyanobacteria (Trichodesmium genus) was given by Nguyen & Doan [20]. Therefore, having an overview of microalgae re- sources as species composition, distribution, available stock and taxonomic system especially is a necessary requirement. Many taxonomic researches of microalgae have carried out by Vietnamese scientists for years, but they have still mainly based on the morphologic ob- servation, which requires considerable taxonomic expe- rience and is sometimes laborious and time-consuming [12]. However, these works have met a serious matter
62 DANG et al.
and interstriae of at least 30 randomly selected cells.
DNA primer design
Partial sequences of the 18S rDNA and the ITS re- gion sequences were aligned to design PCR primers.
By comparison of the sequences of 10 species of Pseudo-nitzschia: P. calliantha Lundholm, Moestrup et Hasle (GenBank accession no. AY257856), P. cus- pidate (Hasle) Hasle 1993 (AY257853), P. caciantha Lundholm, Moestrup et Hasle 2003 (AY257861), P.
delicatissima (Cleve) Heiden (AY257849), P. fraudu- lenta (Cleve) Hasle (AY257840), P. galaxiae Lundholm et Moestrup (AY257850), P. multiseries (Hasle) Hasle (AY257844), P. seriata (Cleve) H.
Peragallo (AY257841), P. pungens (Grunow ex Cleve) Hasle (AY257845), P. australis Frenguelli (AY452528); the Pseu F–Pseu R (Pseu F 5’- GGATCATTACCACACCGATCCAAG -3’; Pseu R 5’- CGCAGATTCACATCCTGAGCTAGT -3’) pri- mer pairs were designed to be specific amplification of the partial 18S rDNA and the ITS region for genus Pseudo-nitzschia.
DNA extraction, amplification, cloning and sequencing
Cultured cells in exponential growth phase were har- vested by collection of samples onto 25-mm-diameter hydrophilic Durapore membranes (0.65-µm pore size;
Millipore) by using vacuum filtration. Filters were transferred to tubes containing 400 µl of lysis solution (50 mM glycine, 10 mM EDTA, 5% [vol/vol] N-laur- oylsarcosine, 0.5% [vol/vol] ProClin 150 [Rohm and Haas, Philadelphia, Pa.], pH 11), vortexes gently, and then heated to 85°C for 5 min. Afterward, 600 µl of sample buffer (100 mM Tris, 17 mM EDTA, 8.35%
formamide, 5 M guanidine thiocyanate, pH 7.5) was added to each tube, the tubes were capped with filter tips (Saigene Corporation, Bothell, Wash.), the contents were mixed, and the samples were pushed through the filters into clean tubes to remove particulates. The sam- ples were stored at -70°C until use [3].
Maintenance of genomic DNA preparation was as de- scribed in Dang et al. [5]. The length of PCR product of P. sp. G3 was approximately 825 bp. The PCR mix- ture (20 μL) contained 2 μL 10X PCR buffer, 0.75 mM of deoxyribonucleoside triphosphate (dNTP) mixture (Takara, Japan), 0.5 mM of each primer, 50-100 ng of genomic DNA, 0.075 units of Taq DNA polymerase
and distilled water. The amplification parameters were 94oC for 3 min, followed by 35 cycles of 94oC for 30 second, 55oC for 1 min, 72oC for 1 min and, finally, 72°C for 5 min, and stored at 4oC. To confirm the pres- ence of amplified DNA fragments of ITS, PCR products were separated electrophoretically on 1.0% agarose gel in TAE buffer stained with ethidium bromide (0.5μ g/mL). Afterward, PCR product was cloned according to TOPO kit (Invitrogen). Recombinant plasmids were transformed into E. coli DH5α strain T1’. The results of cloning were confirmed by PCR checking method and restriction analysis by Eco RI enzyme according to previously reported [5]. Then the DNA plasmids were sequenced using an autosequencer - ABI PRISM 3100 Avant genetic Analyzer (USA) with a Big Dye
(R) Terminator v3.1 Cycle Sequencing Ready Reaction Kit. Both strands of at least two different recombinants were sequenced to check for PCR errors generated in the amplification procedure.
Sequence analysis
The sequence data was evaluated using the BLAST program against released sequences in GenBank (http://www.ncbi.nlm.nih.gov). The searching con- firmed that the sequences were the complete ITS1, ITS2 and 5.8 S rDNA. The ITS sequences were initially aligned using ClustalX [26] and afterwards edited man- ually in BIOEDIT [7], non-alignable regions were ex- cluded before the phylogenetic analyses. This and pre- viously published sequences (Table 1) were used in the phylogenetic analysis. The final data set comprised 23 taxa and 720 positions. Genetic distance values were calculated by using the aligned DNA sequences accord- ing to the Kimura 2-parameter model. Phylogenetic tree was inferred by use of the neighbor-joining (NJ) algo- rithm [22] in MEGA3 [13] applied the bootstrap analy- sis from 1,000 bootstrap replications.
Results and Discussion
Morphological studies of Pseudo-nitzschia Diatoms can usually be recognized in the light micro- scope by the solid, siliceous cell wall (frustule). Each frus- tule consists of two valves, an upper part (epivalve) and a lower part (hypovalve). The girdle between the valves consists of a number of bands. Based on the shape and structure of the valves, the diatoms are divided into two groups, the centric and the pennate diatoms. The valves
Table 1. Strains of Pseudo-nitzschia species used in the phylogenetic analysis, with origin of isolate, GenBank accession number, and citation
Taxon Sample
designation Origin Source Accession
number
P. pseudodelicatissima P-11 Gafahna, Portugal N. Lundholm AY257854
P. calliantha
DS2 Do Son, North Vietnam J. Skov AY257856
HA-D4 Ha Long Bay, North Vietnam J. Skov AY257857
TA-1 Thuan An, Central Vietnam J. Skov AY257855
P. cuspidata Tenerife8 Tenerife, Canary Islands N. Lundholm AY257853
Pseudo-nitzschia sp. Hobart5 Hobart, Tasmania, Australia L. Holtegaard AY257851
P. caciantha Mex20 Near Tuxpam, Mexico N. Lundholm/ ∅. Moestrup AY257861
P. delicatissima Læs∅ 5 Kattegat, Denmark N. Lundholm AY257849
P. fraudulenta Limens1 Limens, Spain K. Grot∅l/N. Lundholm AY257840
P. galaxiae Mex23 Near Tuxpam, Mexico N. Lundholm/ ∅. Moestrup AY257850
P. micropora VPB-B3 Van Phong Bay, Vietnam J. Skov AY257847
P. multiseries Mu3 Monterey Bay, CA, USA P. miller, C. Scholin AY257844
P. multistriata Korea A Chinhae Bay, Korea E. Cho AY257843
P. seriata Nissum3 Nissum Bredning, Denmark N. Lundholm AY257841
P. cf. subpacifica RdA8 Ria de Arousa, Spain N. Lundholm AY257860
P. turgiduloides 3-19 Ross Sea, 75o59’S, 145o019’W N. Lundholm / N. Daugbjerg AY257839 P. pungens
G3* Do Son, Vietnam H. Dang DQ166533
P-24 Costa Nova, Portugal N. Lundholm AY257845
Mex18 Near Tuxpam, Mexico ∅. Moestrup AY257846
P. australis PLYSt54B J. Fehling AY452528
P. inflatula No7 Phuket, Thailand K. Priisholm DQ329204
P. dolorosa BP2 Boca Piccola, Italy N. Lundholm DQ336155
P. cf. australis 6/24/03 B Monterey Bay, CA, USA H. A. Bowers AY559850
* The isolated strain in this study
of the centre diatoms are radially symmetrical and more or less circular, while the valves of the pennate diatoms are bilaterally symmetrical and usually elongate or wedge-shape. Species of Pseudo-nitzschia are marine, planktonic, pennate diatoms with worldwide distribution.
The genus comprises more than 20 species. Based on morphological, physiological and genetic investigations of the type species of Nitzschia, Hasle [10] reinstated Pseudo-nitzschia at the genetic level. Pseudo-nitzschia is characterized mainly by the needle-shape cells and the colony form where the cells overlap by the ends of the valves to form stepped colonies. Both single cells and colonies of Pseudo-nitzschia are capable of moving back and forth in the longitudinally direction, but in- dividual cells in a colony cannot move. The raphe, which is strongly eccentric, is visible as a fine slit at the margin of the frustule. Some species of Pseudo-nitzschia possess a central nodule which is visible in the interspace be- tween the two central fibulae. Hasle & Syvertsen [11]
divided Pseudo-nitzschia into two subgroups: the deli- catissima-group (≤ 3 μm wide) and the seriata-group (> 3 μm wide). In the Vietnamese material, most spe- cies (8 out of 11) belong in the delicatissima-group.
The shape and symmetry of the cells, cells dimensions, and the detailed morphology of the frustules are im- portant feature for identification of species of Pseudo-nitzschia. Only some of these details can be seen in the light microscope (LM), and electron microscopy (EM) is usually necessary for species identification. The genus has been subject to immense attention since the first outbreak of Amnesic Shellfish Poisoning (ASP) in 1987 [14]. The toxin is produced primarily in the sta- tionary growth phase [21]. Other studies have shown that both toxic and non-toxic clones of the same species exist, and the physiological conditions for toxin pro- duction are not yet fully understood. The demand for quick and easy demonstration, e.g. in monitoring pro- grammes, caused Scholin et al. [23] to develop spe-
64 DANG et al.
cies-specific fluorescent labeled molecular probes (large –subunit ribosomal RNA (LSU rRNA) targeted oligo- nucleotide probes) for species identification. In practice, different Pseudo-nitzschia species in natural samples can be discriminated within hours [14].
Morphological studies of Pseudo-nitzschia sp. G3
The observation under light microscopy of Pseudo-nitzschia sp. G3 isolated from Do Son, Hai Phong, Vietnam seem to be P. pungens (Grunow ex Cleve) Hasle (Fig. 2). The frustules are symmetrical, linear to lanceolate in both valve and girdle view, the last 1/4 of the cell the sides are tapering towards the apices. The apices are rounded. The cell length is 80-116 μm, the width is 2-3.8 μm. The valves are strongly silicified. A central interspace is absent. Cell overlap 1/4 -1/3.
Under transmission electron microscope, the number of interstriae and fibulae in 10μm is (8)-9-12-(13) and 9-13-(15), respectively. There are consistently two rows of round periods and 2-3-(4) in 1 μm.
The observations of P. pungens from Vietnamese wa- ters are in good accordance with findings from other parts of the word [25]. The cell shape and morpho- metric measures of cultured material did not change compared to natural material. P. pungens belongs in the seriata-group, but narrow cells may be less than 3 μm wide. In this case, it may be confused with and
A B
Fig. 2. TEM image of Pseudo-nitzschia sp. strain G3. A.
Central part of valve; the two rows of round poroids are clear- ly visible. B. The apical end of a valve.
P. cuspidate or P. pseudodelicatissima, but both have a central interspace.
P. pungens is very common species in Vietnam coast- al waters. It occurred more or less all year round at all the sites from the north to the south of Vietnam.
It was found at temperatures from 20～30oC, and all salinities from 14.5～34.5 ‰. Fryxell & Haslle [6] in- dicate P. pungens as a neritic, cosmopolitan species.
Phylogenetic analysis of Pseudo-nitzschia sp. G3 based on ITS region sequences
The morphological studies of used species in this re- port belonging to genus Pseudo-nitzschia was supported by phylogenetic analyses of the ITS region sequences.
For reconstructing, the phylogenetic tree was used the different ITS region sequences from DNA databases from BLAST searches such as 23 sequences of 19 dia- tom species of genus Pseudo-nitzschia.
Based on phylogenetic tree and genetic homogenous coefficient matrix, the identification of Pseudo-nitz- schia was carried out. Homogeneous coefficient of P.
sp. G3 (DQ166533) with P. pungens (Grunow ex Cleve) Hasle (accession number AY257845 and AY257846) reached to the most highest (98.75%), then with P. multiseries (Hasle) Hasle (83.2%), P. cf autralis Frenguelli (79.4%) and so on. Figure 3 shows the ITS regions of sequences with base differences between P.
sp. G3 and P. pungens (AY257846). Within the ITS1 region (259 bp), 3 base differences were found between P. sp. G3 and P. pungens: 3 transitions (positions 54, 86 and 135). This represents a sequence dissimilarity (number of base differences divided by sequence length) of only 0.0116. Only one difference (transition, position 432)) was found between the sequences of the 5.8S rDNA gene (171 bases), the dissimilarity was 0.0058. The dissimilarity between P. sp. G3 and P. pun- gens sequences in the ITS-2 region (263 bases) was 0.019. They differd in 5 bases: four transitions and one transversion (positions 455, 570, 605, 620 and 625, re- spectively). Taking into account the full ITS1, 5.8, ITS2 sequences (720 bp), the sequence dissimilarity was only 0.0125 between P. sp. G3 and P. pungens, representing a sequence identity of 98.75%. In addition, figure 4 was showed that species of P. sp. G3 (DQ166533) is beside P. pungens (Grunow ex Cleve) Hasle (bootstrap values 100%). Thus support to make the conclusion that P.
sp. G3, which isolated from northern coast of Vietnam, was considered under species name, P. pungens
66 DANG et al.
(Grunow ex Cleve) Hasle. The nucleotide sequence of partial 18S small subunit ribosomal RNA gene (18S rDNA) and the internal transcribed spacer 1–5.8S–in- ternal transcribed 2 from the studied P. pungens species has been submitted to GenBank and given the following accession number: DQ166533.
These obtained results in this present study strongly suggest that morphology still is reliable tool to differ- entiate Pseudo-nitzschia species. The species in this ge- nus must be defined considering both the morphology and the phylogenetic relationships revealed here.
Acknowledgement
This study was supported in part by a grant Vietnamese National Project with Accession No.
KC-09-15. The authors thank Dr. Chu Van Thuoc (Hai Phong Institute of Ocenology, Vietnamese Academy of Science and Technology) for kindly providing samples and Prof. Yong-Ki Hong, Department of Biotechnol- ogy, Pukyong National University, Pusan 608-737, Korea for the critical comments and suggestions for the improvement of the manuscript.
References
1. Bakker, F. T., Olsen, J. L. & Stam, W. T. 1995. Evolution of the nuclear rDNA ITS sequences in the Cladophora albida/sericea clade (Chlorophyta). J. Mol. Evol. 40, 640-651.
2. Baldwin, B. G., Sanderson, M. J., Porter, J. M., Wojciechowski, M. F. & Donohue, M. J. 1995. The ITS region of nuclear ribosomal DNA: a valuable source of evidence on angiosperm phylogeny. Ann. Miss. Bot.
Gard. 82, 247-277.
3. Cangelosi, G. A., A.M. Hamlin, R. Marin and C.A.
Scholin. 1997. Detection of stable pre-rRNA in toxigenic Pseudo-nitzschia species. Appl. Environ. Microbiol. 63, 4859-4865.
4. Coleman, A. W. & Mai, J. C. 1997. Ribosomal DNA ITS-1 and ITS-2 sequence comparisons as a tool for pre- dicting genetic relatedness. J. Mol. Evol. 45, 168-177.
5. Dang, D. H., H. T. M. Hien, P. N. Son, N. D. Bach, N. V. Dong. 2002. Phylogenetic characterization of some Vietnamese algae based on their ITS-1 sequences. J. Sci.
Technol. 40, 161-167.
6. Fryxell, G. A. & Halse, G. R.: Taxonomy of harmful diatoms. 2004.–In: Hallegraeff, G. M., Anderson, D. M., Cembella, A. D. (eds), Manual on harmful marine micro- algae, Monographs on oceanographic methodology 11, Unesco, Paris, 465-509.
7. Hall, T. A. 1999. BioEdit: a user friendly biological se- quence alignment editor and analysis program for win-
dows 95}98}NT. Nucleic Acids Symposium Series. 41, 95-98.
8. Hallegraeff, G.M., D.M. Anderson, A.D. Cembella. 2004.
Manual on Harmful Marine Microalgae. Monographs on Oceanographic Methodology 11, Unesco, Paris.
9. Hasle, G. R. 1965. Nitzschia and Fragilariopsis species studied in the light and electron microscopes. II. The group Pseudo-nitzschia. Skr. Norske Vidensk-Akad. I.
Mat.-Nat. Kl. Ny Serie. 18, 1-45.
10. Halse, G. R. 1994. Pseudo-nitzschia as a genus distinct from Nitzschia (Bacillariophyceae). J. Phycol. 30, 1036- 1039.
11. Hasle, G. R. & Syvertsen, E. E. 1996. Marine diatoms.
In Tomas, C. R. [Ed.] Identifying Marine Phytoplankton.
Academic Press, San Diego, 5-385.
12. Ki, J.S. and M.S. Han. 2005. Molecular analysis of com- plete SSU to LSU rDNA sequence in the harmful Dinoflagellate Alexandrium tamarense (Korean isolate, HY970328M). Ocean Sci.J. 40, 155-166.
13. Kumar, S., K. Tamura and M. Nei. 2004. MEGA3:
Integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief.Bioinformat. 5, 150-163.
14. Larsen, J. and N.L. Nguyen. 2004. Dinophysiales. In:
Potentially toxic microalgae of Vietnamese Waters (Eds:
J. Larsen and L. Nguyen-Ngoc). Council for Nordic Publications in Botany, Copenhagen, Denmark. 233-252.
15. Lefebvre, K.A., Powell, C.L., Busman, M., Doucette, G.J., Moeller, P.D.R., Silver, J.B., Miller, P.E., Hughes, M.P., Singaram, S., Silver, M.W. & Tjeerdema, R.S.
1999. Detection of domoic acid in northern anchovies and California sea lions associated with an unusual mor- tality event. Natural Toxins. 7, 85-92.
16. Lundholm, N., Daugbjerg, N. & Moestrup, Ø. 2002.
Phylogeny of the Bacillariaceae with emphasis on the genus Pseudo-nitzschia (Bacillariophyceae) based on par- tial LSU rDNA. Eur. J. Phycol. 37, 115-134.
17. Lundholm, N., Moestrup, Ø., Hasle, G. R. & Hoef- Emden, K. 2003. What is Pseudo-nitzschia pseudodelica- tissima? A study of the P. pseudo-delicatissima/cuspidata complex (Bacillariophyceae). J. Phycol. 39, 797-813.
18. Mai, J. C. & Coleman, A. W. 1997. The internal tran- scribed spacer 2 exhibits a common secondary structure in green algae and flowering plants. J. Mol. Evol. 44, 258-271.
19. Manhart, J. R., Fryxell, G. A., Villac, M. C. & Segura, L. Y. 1995. Pseudo-nitzschia pungens and P. multiseries (Bacillariophyceae): nuclear ribosomal DNAs and spe- cies differences. J. Phycol. 31, 421-427.
20. Nguyen, N.L. and N.H. Doan. 1997. The distribution of species composition and cell density of phytoplankton in the central Vietnam. Proceedings of the National Conference on Marine Biology, Nha Trang, Vietnam.
Science and Technology Publishing House, Hanoi.
195-208.
21. Pan, Y., Parson, M. L., Busman, M., Moller, P. D. R., Dortch, Q., Powell, C. L. & Doucette, G. J. 2000.
Production of domoic acid by Pseudo-nitzschia pseudo-
delicatissima from the northern gulf of Mexico.–In:
Conference Abstracts of the Ninth International Conference on Harmful Algal Blooms, 7-11 February 2000. Wrest Point Convention Centre, Hobart, Tasmania, Australia. p. 192.
22. Saito, N. and M. Nei. 1987. The neighbor–joining meth- od: A new method for reconstructing phylogenetic tress.
Mol.Biol.Evol. 4, 406-425.
23. Scholin, C. A., Buck, K. R., Britschgi, T., Cangelosi, G.
& Chavez, F. P. 1996. Identification of Pseudo-nitzschia australis (Bacillariophyceae) using rRNA-targeted probes in whole cell and sandwich hybridization formats.
Phycologia. 35, 190-197.
24. Scholin, C.A., Gulland, F., Doucette, G.J., Benson, S., Busman, M., Chavez, F.P., Cordaro, J., Delong, R., De Vogelaere, A.D., Harvey, J., Haulena, M., Lefebvre, K., Lipscomb, T., Loscutoff, S., Lowenstine, L.J., Marin III, R., Miller, P.E., McLellan, W.A.,Moeller, P.D.R., Powell, C.L., Rowles, T., Silvagni, P., Silver, M., Spraker, T., Trainer, V. & Van Dolah, F.M. 2000.
Mortality of sea lions along the central California coast linked to a toxic diatom bloom. Nature. 403, 80-84.
25. Skov, J., Lundholm, N., Moestrup, Ø. & Larsen, J. 1999.
Potentially toxic phytoplankton 4. The diatom genus Pseudo-nitzschia (Diatomophyceae/Bacillariophyceae).
In Lindley, J. A. [Ed.] ICES Identification Leaflets for Plankton. No. 185. ICES, Palægade 2-4, DK-1261 Copenhagen. p. 23.
26. Thompson, J.D., T.J. Gibson, F. Plewniak, F. Jeanmougin and D.G. Higgins. 1997. The ClustalX windows inter- face: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 24, 4876-4882.
27. Work, T.M., Beale, A.M., Fritz, L., Quilliam, M.A., Silver, M., Buck, K. &Wright, J.L.C. 1993. Domoic acid intoxication of brown pelicans and cormorants in Santa Cruz, California. In Toxic Phytoplankton Blooms in the Sea (Smayda, T.J. & Shimizu, Y., editors). Elsevier, Amsterdam. 643-649.
