Tae-Ho Park () 대구대학교 원예학과
(Department of Horticulture, Daegu University, Gyeongsan 38453, South Korea)
e-mail: [email protected]
가지속 식물의 엽록체 전장유전체 비교를 통한 PCR 기반의 Solanum demissum 특이적 분자마커 개발
박태호
PCR-based markers for discriminating Solanum demissum were developed by comparison of complete chloroplast genome sequences of Solanum species
Tae-Ho Park
Received: 17 March 2021 / Revised: 26 March 2021 / Accepted: 26 March 2021
ⓒ Korean Society for Plant Biotechnology
This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract Solanum demissum is one of the wild Solanum species originating from Mexico. It has wildly been used for potato breeding due to its resistance to Phytophthora infestans. S. demissum has an EBN value of four, which is same as that of S. tuberosum, so that it is directly crossable for breeding purposes with the cultivated tetraploid potato (S. tuberosum). In this study, the chloroplast genome sequence of S. demissum obtained by next-generation sequencing technology was described and compared with those of seven other Solanum species to develop S. demissum-specific markers. Thetotal sequence length of the chloroplast genome is 155,558 bp, and its structural organization is similar to those of other Solanum species. Phylogenetic analysis with ten other Solanaceae species revealed that S. demissum is most closely grouped with S. hougasii and S. stoloniferum followed by S. berthaultii and S. tuberosum. Additional comparison of the chloroplast genome sequence with those of seven other Solanum species revealed two InDels specific to S. demissum. Based on these InDels, two PCR-based markers for discriminating S. demissum from other Solanum species were developed. The results obtained in this study will provide an opportunity to investigate more detailed evolutionary and breeding aspects in Solanum species.
Keywords cpDNA, InDels, PCR-based marker, Potato, Solanum demissum
서 언
Solanum demissum은 멕시코에서 자생하는 6배체의 괴경을 형성하는 감자(Solanum tuberosum L.) 야생종 중의 하나이다.
이 야생종은 감자에서 Phytophthora infestans에 의해 발생하 는 감자 역병(late blight)에 저항성을 보여 이에 대해 가장 중 요한 재료로 알려져 있으며 이미 레이스 특이적인 다수의 유 전자가 재배종 감자에 도입되어 활용되었다(Park et al. 2009;
Plastied and Hoopes 1989; Ross 1986). 이 야생종의 EBN (Endo- sperm Balanced Number)은 4로 4배체의 재배종 감자와 동일 한 EBN을 가지고 있어 직접적인 교배를 통해 새로운 품종을 육성하는데 이용될 수 있으며(Cho et al. 1997; Hanneman 1994; Hawkes 1990; Johnston and Hanneman 1980; Ortiz and Ehlenfeldt 1992; Spooner et al. 2014), 실제 재배종 감자인 S.
tuberosum과의 교잡으로 잡종 세대를 어렵지 않게 얻을 수 있
었다(Dionne 1961; Sanetomo et al. 2011). 이에 더해, 감자 야생
종들의 유전체 구성이 유전자 및 GISH (Genomic in situ
hybridization) 분석 등에 의해 진화적으로 구명되었는데,
AABBPP 게놈 구성으로 이질6배체로 확인된 S. hougasii를
포함한 몇몇 야생종의 경우 이질배수성인 반면 S. demissum
의 경우 AA 게놈 기반의 동질6배체 인 것으로 확인되었다
(Ono et al. 2016; Pendinen et al. 2012; Spooner et al. 2008). 하지
만, 이러한 결과는 핵내 게놈 분석의 결과로 진화적 관점에
서 미토콘드리아나 색소체의 게놈(cpDNA 또는 mtDNA) 분
Research Article
석과 관련된 연구는 거의 없어, 본 연구에서의 S. demissum 엽 록체 전장 유전체의 결과는 다른 야생종과의 비교 분석을 통 해 다양한 배수성을 보이는 가지속(Solanum) 야생종의 진화 와 관련된 좀 더 심도 깊은 연구를 가능하게 할 것이며, S.
demissum cpDNA와 다른 야생종 또는 재배종 감자 cpDNA와 의 비교 분석을 통해 개발된 PCR 기반의 분자마커는 감자의 품종 육성에 기여할 수 있을 것이다.
웅성불임이나 광합성 등과 같은 특별한 기능을 하는 유전 자들로 구성되어 있는 cpDNA 및 mtDNA와 같은 세포질 유 전체는 이들만의 특이한 유전체 구성을 가지고 있으며(Jheng et al. 2012; Ruiz and Daniell 2005), 감자 cpDNA의 경우 A, C, S, T, W 등 다섯 가지의 타입을 가지고 있으며, 대부분 재배종 감자의 경우 T 타입의 cpDNA와 함께 β 타입의 mtDNA를 가 지고 있는 것으로 알려져 있다(Hosaka 2002; Hosaka and Hanneman 1988; Hosaka and Sanetome 2012). 또한, 보고된 감 자와 감자 야생종 cpDNA의 유전적 구성 및 구조와 크기 등 은 다른 식물들과 유사하게 한 쌍의 IR (Inverted Repeat)과 LSC (Large Single Copy) 및 SSC (Small Single Copy) 영역으로 4분할 되어 있으며, 대부분의 cpDNA는 다양한 단백질, rRNA, tRNA로 코딩되는 130여개 유전자로 구성되어 매우 유사한 것으로 알려져 있다(Palmer 1991; Raubeson and Jansen 2005;
Saski et al. 2005; Sugiura et al. 1998; Yurina and Odintosova 1998). 하지만, 여전히 많은 식물종 간에는 cpDNA에서의 유 전자 역위 및 재배치 등에 따른 SNP나 InDel과 같은 다형성 이 나타나 이러한 정보를 통해 종 특이적 분자마커 개발이 가능하여 그 연구의 필요성이 여전히 존재하고 있다(Calsa Junior et al. 2004; Cho et al. 2015; Jheng et al. 2012; Kim et al.
2015; Kim and Park 2019, 2020a, 2020b; Saski et al. 2005).
이에 본 연구에서는 앞서 Cho et al. (2019)에 의해 간략히 보고된 바 있는 S. demissum의 전체 cpDNA에 대해 상세 정보 를 제공하며, 이와 가지과(Solanaceae)의 다른 종들의 cpDNA 와 비교 분석하고 그 결과를 이용해 PCR 기반의 S. demissum 특이적 분자마커를 개발한 결과를 제공하고자 한다.
재료 및 방법
식물 재료 및 DNA 분리
S. demissum의 cpDNA 분석을 위해 국립식량과학원 고령지 농업연구소로부터 분양 받은 계통 중 하나인 SD9가 이용되 었으며, S. demissum 특이적 분자마커 개발을 위해서는 SD9 에 더해 S. demissum의 SD7 계통 하나가 추가되었으며, 이외 재배종 감자인 ‘서홍’(SH), ‘하령’(HR), ‘대지’(DJ)와 감자 야 생종 S. acaule (PI310970, SA), S. berthaultii (PI310981, SB1), S.
brevicaule (PI205394, SB2), S. candolleanum (PI210035, SC4), S. cardiophyllum (PI341233, SC1), S. chacoense (PI201846, SC3),
S. commersonii (PI558050, SC2), S. iopetalum (PI230459, SI), S.
kurtzianum (PI498422, SK), S. jamesii (PI578236, SJ), S. micro- dontum (PI310979, SM2), S. mochiquense (PI338616, SM1), S.
pinnatisectum (PI190115, SP), S. stoloniferum (PI160224, SS), S.
vernei (PI230468, SV2), S. verrucosum (PI160228, SV1)의 계통 이 이용되었다.
모든 식물 재료는 기내 또는 온실에서 관리 및 유지되었으며, Genomic DNA Extraction kit (Plants) (RBC, New Taipei City, Taiwan) 를 이용하여 약 100mg의 잎을 채취하여 DNA를 분리하였다.
엽록체 전장유전체 분석
S. demissum cpDNA 분석은 S. demissum 계통 SD9를 대상으로 genomic DNA를 추출하고 Macrogen (Macrogen, Seoul, South Korea)의 Illumina Hiseq2000 (Illumina, SanDiego, CA, USA)의 플랫폼을 이용하여 진행되었다. 확보된 전체 염기서열 정보 에서 cpDNA 염기서열 추출과 유전체 서열 조립을 위해 파이 젠에 구축된 생물정보학 파이프라인(http://phyzen.com) (Cho et al. 2015), 4.06 beta version CLC genome assembler (CLC Inc, Rarhus, Denmark), Nucmer (Kurtz et al. 2004) 등이 이용되었다.
이후, 앞서 보고된 155,533 bp의 S. berthaultii cpDNA (KY419708, Park 2017; Kim et al. 2018)와 비교하고 구성된 대표 콘티그들 을 BLASTZ 분석한 후, 일부 영역을 편집하여 정렬하여 그 구조와 염기서열을 확인하였다 (Cho et al. 2016; Schwartz et al. 2003).
S. demissum cpDNA의 유전자 분석은 Blast search를 기반하 여 Geseq 프로그램을 이용하여 진행하였으며(Tillich et al.
2017), S. demissum cpDNA의 유전자지도는 OGDraw (Organellar GenomeDRAW; http://ogdraw.mpimp-golm.mpg.de) 프로그램 을 이용하여 작성되었다(Lohse et al. 2013).
엽록체 전장유전체의 비교
S. demissum cpDNA 분석의 결과로 얻어진 전체 염기서열은 기존의 연구결과로 NCBI (the National Center for Biotech- nology Information)에 등록되어 있는 가지과 (Solanaceae)에 속한 10개 종의 cpDNA 전체 염기서열과 비교하여 계통수를 작성하였다. 비교된 10개 종은 Capsicum annuum (JX270811), S. berthaultii (KY419708), S. bulbocastanum (DQ347958), S.
chacoense (MF471371), S. commersonii (KM489054), S. hougasii
(MF471372), S. lycopersicum (NC007898), S. nigrum (KM489055),
S. stoloniferum (MF471373), S. tuberosum (KM489056 및
NC008096)이며, S. demissum을 포함하는 총 12개의 전체
cpDNA로부터 엽록체 코딩 서열을 분석하고 이를 대상으로
Kimura 2-parameter 모델과 1,000번의 Bootstrap 옵션을 이용
한 Maximum likelihood 방법에 의해 계통수를 분석하였다
(Tamura et al. 2013).
Fig. 1 Result of assembling the complete chloroplast genome sequence of S. demissum. The four representative contigs for the chloroplast genome of S. demissum and comparison with the corresponding regions of the S. berthaultii chloroplast genome (KY419708) are combined. Blue and yellow bars indicate contig matching with the reference sequence in forward and reverse orientations, respectively
PCR 기반의 S. demissum 특이적 분자마커 개발을 위해서 는 확보한 S. demissum cpDNA 전체 염기서열을 S. acaule (MK036506), S. brevicaule (MK036507), S. bulbocastanum (DQ347958), S. chacoense (MF471371), S. commersonii (KM489054), S. stolonioferum (MF471373), S. tuberosum (KM489056)의 cpDNA 전체 염기서열과 함께 EMBL (http://www.ebi.ac.uk/
Tools/msa/clustalw2)의 ClustalW2에 의해 다중 정렬되었으며, 이 결과를 통해 S. demissum 특이적 InDel 영역이 구명되었다.
PCR 기반의 분자마커 개발
8종의 cpDNA 전체 염기서열을 대상으로 한 다중 정렬의 결 과로 구명된 S. demissum 특이적 InDel을 대상으로 S. demissum 특이성 검증이 수행되었다. 각각의 InDel 영역에 특이적인 프라이머를 제작하였으며, S. demissum과 S. tuberosum을 포 함하여 총 21개의 유전자 계통, S. demissum (SD7 및 SC9), S.
tuberosum (감자품종 ‘서홍(Seohong)’, ‘하령(Haryeong)’ 및
‘대지(Daeji)’), S. acaule (SA), S. berthaultii (SB1), S. brevicaule (SB2), S. candolleanum (SC4), S. cardiophyllum (SC1), S.
chacoense (SC3), S. commersonii (SC2), S. iopetalum (SI), S.
kurtzianum (SK), S. jamesii (SJ), S. microdontum (SM2), S.
mochiquense (SM1), S. pinnatisectum (SP), S. stoloniferum (SS), S. vernei (SV2) and S. verrucosum (SV1)을 대상으로 PCR을 수 행하였다. 총 25 ul 볼륨 (약 20 ng genomic DNA, 0.5 mM dNTPs, 10 pMol each primer, 1 U Taq polymerase (Genetbio, Daejeon, South Korea))으로 Thermocycler (Biometra, Göttingen, Germany) 를 이용하여 PCR 한 후, 핵산염색용액인 RedSafe (Intron Biotechnology, Seongnam, South Korea)를 이용하여 1% agarose gel에서 확인하였다.
결과 및 고찰
감자 야생종 S. demissum 엽록체 전장유전체 완성
NGS (Next-Generation Sequencing) 기술에 의해 완성된 S.
demissum의 엽록체 전장유전체(cpDNA)는 앞서 간략히 보고 된 바 있다(Cho et al. 2019). 전체 염기서열의 완성 과정을 추
가해 기술하자면 Illumina의 PE 표준 프로코콜에 의해 평균 길이가 288.5 bp인 염기서열 정보 총 3,163,006,686 bp를 얻은 후, Trimmed read를 CLC de novo assembler 프로그램을 이용 하여 엽록체 유전체 유래 컨티그 만을 선별하고, 이를 확장 하고 gap-filling 과정을 거쳐 완성되었다. 완성된 염기서열은 S. berthaultii cpDNA 전체 염기서열(KY419708, Park 2017;
Kim et al. 2018)과 비교하고 BLASTZ 분석의 결과를 종합하 여 엽록체 전장 유전체를 조립하여 3개의 대표 컨티그를 형 성하였다(Schwartz et al. 2003) (Fig. 1). 추정되는 염기서열의 오류는 1,195.07x의 데이터를 맵핑하는 과정과 한 쌍의 inverted repeat 영역(IRs), small single copy 영영(SSC), large single copy 영역(LSC) 간의 경계 부분의 염기서열을 포함하는 다수의 영역을 대상으로 한 PCR과 ABI3730에 의한 BigDye Terminator Cycle Sequencing에 의해 수정되었다. 최종적인 S. demissum 의 cpDNA는 대다수 일반적인 식물의 cpDNA와 같이 원형의 이중가닥 분자로 이루어져 있으며 총 cpDNA의 크기는 155,558 bp였다(Cho et al. 2019; GeneBank accession no. MK036508). 세 부적인 구조는 18,373 bp의 SSC 영역과 85,999 bp의 LSC 영역 을 연결하는 25,593 bp의 IR 영역으로 구성된 전형적인 4분 할 구조이며, 다른 Solanum 속의 다른 종들과 비교할 때 약간 긴 편이나, S. stoloniferum 보다는 9 bp 짧은 것으로 나타났다 (Table 1).
S. demissum의 전체 cpDNA에는 105개의 단백질 코딩 유전 자, 45개의 tRNA, 8개의 rRNA 등, 총 158개의 유전자를 포함 하고 있으며, 이 중 각각 11개, 9개, 4개 등 총 24개가 한 쌍의 IR 영역에서 역배열로 중복되어 있었다(Table 1, Fig. 2). 전체 염기서열 중 59.2%가 평균 583.1 bp의 크기로 코딩 영역이었 으며, 단백질 코딩유전자와 RNA(tRNA 및 rRNA)가 각각 평 균 764.6 bp, 223.6 bp의 크기로 51.6%와 7.6%의 비율로 분포 되어 있었다. GC의 함량은 37.25%이며, 유전자, tRNA, rRNA 등의 개수, 순서 등이 모두 다른 Solanum 속의 종들과 유사한 것으로 나타났다(Table 1) (Cho et al. 2016; Cho and Park 2016;
Kim et al. 2018; Kim and Park, 2019).
엽록체 전장유전체 비교 및 계통수
S. demissum cpDNA는 계통수 작성을 위해 가지과에 속하는
다른 10종의 cpDNA의 코딩 서열과 비교 분석되었다(Fig. 3).
Table 1 Results of comparative analysis of the chloroplast genome sequence of S. demissum with those of the cultivated potato, seven other Solanum species
Species Accession
no. Total Length
(bp) GC content
(%) Total No.
of genes No. of
tRNA No. of
rRNA Reference
S. demissum MK036508155,558 37.8 7 135 36 4 In this study
S. hougasii MF471372 155,549 37.87 135 36 4 Kim and Park (2020b)
S. stoloniferum MF471373 155,567 37.87 135 36 4 Kim and Park (2020a)
S. chacoense MF471371 155,532 37.89 136 36 4 Kim and Park (2019)
S. berthaultii KY419708 155,533 37.88 137 39 4 Kim et al. (2018)
S. commersonii KM489054 155,525 37.88 133 33 4 Cho et al. (2016)
S. nigrum KM489055 155,432 37.90 139 39 4 Cho and Park (2016)
S. tuberosum KM489056 155,312 37.88 130 30 4 Cho et al. (2016)
S. bulbocastanum DQ347958155,371 37.8 8 133 30 4 Daniell et al. (2006)
S. tuberosum NC008096 155,296 37.88 131 36 4 Gargano et al. (2005)
*The data have been partially adopted from Kim and Park (2020a, 2020b).
Fig. 2 Gene map of the S. demissum chloroplast genome. Genes on the outside of the map are transcribed in the clockwise direction,
and genes on the inside of the map are transcribed in the counterclockwise direction
Fig. 3 Maximum-likelihood phylogenetic tree of S. demissum with eleven Solanaceae family members based on the chloroplast protein-coding sequences of each chloroplast genome. The numbers on each node indicate the bootstrap values from 1,000 replicates
Fig. 4 Multiple alignment of the sequences on the intergenic regions containing InDels used to develop the PCR-based markers. The chloroplast genome sequences of S. acaule (SA11: MK036506), S. brevicaule (SB2-1: MK036507), S. demissum (SD9: MK036508), S. tuberosum (Stub: KM489056), S. commersonii (Scmr: KM489054), S. bulbocastanum (Sblb: DQ347958), S. chacoense (Scha:
MF471371), and S. stoloniferum (Ssto: MF471373) were used and are listed from top to bottom in each region of the InDels. The regions of the InDels detected on that of S. demissum are bold and highlighted
분석에 이용된 방법(maximum likelihood)은 체계적인 분류의 결과를 보여주었을 뿐 만 아니라 높은 부트스트랩(bootstrap) 값은 계통수의 결과를 뒷받침 해 주었다. 결과적으로 계통 수에서 S. demissum은 S. hougasii와 S. stoloniferum의 cpDNA 와 거의 일치하는 수준으로 동일한 그룹으로 분류되었으며, 이후 가장 근접한 Solanum 종은 S. berthaultii와 S. tuberosum이 었다.
S. demissum의 cpDNA를 이용하여 S. demissum과 다른 Solanum 속에 속하는 종들을 구분할 있는 S. demissum 특이적 분자마커를 개발하기 위해 EMBL의 ClustalW2 (https://www.
ebi.ac.uk/Tools/msa/clustalw2)를 이용하여 S. demissum의 cpDNA 와 다른 7개 Solanum 종의 cpDNA 전체를 대상으로 다중 정열 을 수행하였다(Fig. 4). 그 결과, 앞서 보고된 바와 같이 다수 의 InDel과 SNP 영역을 발견할 수 있었으며(Cho and Park 2016; Chung et al. 2006; Kim et al. 2018; Kim and Park 2019), S.
demissum 특이적인 InDel은 삽입과 삭제 각각 1개씩 총 2개의 영역으로 나타났다(Fig. 4).
S. demissum 특이적 분자마커 개발
분자마커의 개발은 다중 정열의 결과로 얻은 2개의 InDel을 대상으로 진행하였다. 이들 특이적 InDel은 전체 cpDNA 영 역 중 비코딩영역에 분포하고 있었다 (Cho and Park 2016;
Chung et al. 2006; Kim and Park 2019). InDel 영역을 대상으로 프라이머를 디자인하여 PCR을 할 경우 분자마커의 다형성 에 의해 효과적으로 식물종을 구별할 수 분자마커를 개발하 여 적용되고 있다(Cho et al. 2015; Garcia-Lor et al. 2013;
Yamaki et al. 2013). 본 연구에서는 앞서 언급된 비코딩영역 (trnC-petN 및 psaA-ycf3)에 존재하는 2개의 S. demissum 특이 적 InDel 영역 모두에서 S. demissum을 다른 종과 명확히 구별 하기 충분하였다. 첫번째 InDel (SD_InDel_1)의 경우 S. demissum 이 다른 Solanum 종과 비교하여 6 bp가 추가적으로 삽입되어 있었으며, 두번째 InDel (SD_InDel_2)의 경우 S. demissum이 다른 Solanum 종과 비교하여 11 bp가 삭제되어 있었다(Fig.
4). 따라서, 이 InDel 영역 특이적인 프라이머를 제작하여 (Table 2), S. demissum을 포함한 총 21개의 Solanum 종들의 계 통을 대상으로 PCR 한 결과 예상한 바와 같이 S. demissum 특 이적인 마커를 개발할 수 있었다. 두개의 InDel 기반의 분자 마커 모두에서 S. demissum 계통인 SD7과 SD9에서만 PCR의 결과로 밴드가 나타나고 나머지에서는 밴드가 나타나지 않 음을 확인하였다(Table 2, Fig. 5A and 5B).
엽록체 전장유전체를 통해 얻은 정보는 감자의 다양한 야
생종들의 진화적인 측면에서의 연구에 활용될 수 있을 뿐 만
아니라 본 연구의 결과와 같이 감자의 야생종을 활용한 신품
종 육성과정에서 그 정보를 활용하여 분자마커를 개발하는
데 활용될 수 있다(Bohs and Olmstead 1997; Hosaka and Sanetomo
2012). 특히, 육종적 측면에서는 Solanum 종을 포함하여 다양
한 식물 종에서 보고된 바와 같이 체세포 융합이나 식물조직
Table 2 Primers used to generate S. demissum-specific markers
Marker name Region S
aPrimer sequence Size (bp)
bSD_InDel_1 trnC-petN
(Intergenic)
F CGATTATAAATCATATACATATA
R TCTATTGAGAGAATCAAATC 956
SD_InDel_2 psaA-ycf3
(Intergenic)
F AGCAGATGAAATAGAAGGC
1,121
R TCTGTCATTACGTGCGAC
a
F and R indicate forward and reverse strands of primers, respectively.
b
The expected sizes of PCR fragments are measured based on the sequence of S. demissum.
Fig. 5 PCR-based markers for the discrimination of S. demissum from other Solanum species. A: SD9_InDel_1. B: SD9_InDel_2.
The two markers are all positively specific to S. demissum. SD7 and SD9 indicate two different lines of S. demissum (PI218047).
M is a size marker ladder. SH, HR, DJ, SA, SB1, SB2, SC4, SC1, SC3, SC2, SI, SK, SJ, SM2, SM1, SP, SS, SV2, and SV1 indicate potato varieties ‘Seohong’, ‘Haryeong’, ‘Daeji’, S. acaule (PI310970), S. berthaultii (PI310981), S. brevicaule (PI205394), S. candolleanum (PI210035), S. cardiophyllum (PI341233), S.
chacoense (PI201846), S. commersonii (PI558050), S. iopetalum (PI230459), S. kurtzianum (PI578236), S. jamesii (PI578326), S.
microdontum (PI310979), S. mochiquense (PI338616), S. pinnatisectum (PI190115), S. stoloniferum (PI160224), S. vernei (PI230468) and S. verrucosum (PI160228), respectively
배양에서 나타나는 재분화 과정에서 cpDNA의 무작위 배분 과 mtDNA (mitochondrial genome)의 높은 재조합 빈도로 인 하여(Chen et al. 2013; Cho et al. 2016; Lössl et al. 2000; Mohapatra et al. 1998; Smyda-Dajmund et al. 2016; Xiang et al. 2004), 체세 포 융합이나 식물조직배양을 통해 얻은 계통들의 세포질 DNA를 구별 또는 선발할 수 있는 분자마커가 필요할 것이 다. 이에, 본 연구에서 개발된 InDel 기반의 마커는 S. demissum 을 다른 Solanum 종과 구별하는데 이용될 수 있으며, S.
demissum을 이용한 감자 품종 육성 과정에서 S. demissum 또 는 S. tuberosum 기반의 적합한 엽록체형 선발을 통해 육종 연 한을 단축하는데 기여할 것이다.
적 요
멕시코로부터 유래한 Solanum demissum은 감자 야생종 중의 하나로 감자 역병에 대해 저항성을 가지고 있어 감자 육종에
서 중요한 재료로 이용되고 있다. S. demissum의 EBN은 4배 체인 감자와 같은 4로 직접적인 교배로 육종에 활용될 수 있 다. 본 연구에서는 NGS 기술에 의해 완성된 S. demissum의 엽 록체 전장 유전체(cpDNA)와 이를 다른 Solanum 종과의 비교 를 통해 개발한 분자마커에 대해 보고하였다. S. demissum의 전체 cpDNA의 크기는 155,558 bp였으며 그 구조는 다른 Solanum 종과 매우 유사하였다. S. demissum의 cpDNA와 가지 과에 속하는 10개 종의 cpDNA 코딩서열을 이용하여 분석한 계통수에서는 S. demissum이 S. hougasii 및 S. stoloniferum과 거의 동일한 유전체 구성을 보였으며, 다음으로 S. berthaultii 및 S. tuberosum과 유연관계가 가까운 것으로 확인되었다. S.
demissum과 다른 7종의 Solanum과의 전체 cpDNA 다중 정렬 을 통해 S. demissum 특이적인 두 개의 InDel 영역을 구명하였 으며 이를 기반으로 최종적으로 PCR을 기반으로 한 두 개의 S. demissum 특이적 마커를 개발하였다. 본 연구의 결과는 Solanum 종들을 대상으로 한 조금 더 세부적인 진화적 그리 고 육종적 측면에서의 연구에 기여를 할 수 있을 것이다.
사 사
이 연구는 2020학년도 대구대학교 연구년 결과물로 제출됨.
References
Bohs L, Olmstead RG (1997) Phylogenetic relationships in Solanum (Solanaceae) based on ndhF sequences. Syst Bot 22:5-17
Calsa Junior T, Carraro DM, Benatti MR, Barbosa AC, Kitajima JP, Carrer H (2004) Structural features and transcript-editing analysis of sugarcane (Saccharum officinarum L.) chloroplast genome. Curr Genet 46:366-373
Chen L, Guo X, Xie C, He L, Cai X, Tian L, Song B, Liu J (2013) Nuclear and cytoplasmic genome components of Solanum tuberosum + S. chacoense somatic hybrids and three SSR alleles related to bacterial wilt resistance. Theor Appl Genet 126:1861-1872
Cho KS, Cheon KS, Hong SY, Cho JH, Im JS, Mekapogu M, Yu YS, Park TH (2016) Complete chloroplast genome sequences of Solanum commersonii and its application to chloroplast
genotype in somatic hybrids with Solanum tuberosum. Plant Cell Rep 35:2113-2123
Cho K-S, Cho J-H, Park Y-E, Park T-H (2019) Chloroplast genome sequence of Solanum demissum, a wild tuber-bearing species was completed. Mitochondr DNA Part B 4:1800-1802 Cho HM, Kim-Lee HY, Om YH, Kim JK (1997) Influence of
endosperm balance number (EBN) in interploidal and interspecific crosses between Solanum tuberosum dihaploids and wild species.
Korean J Breed 29:154-161
Cho KS, Park TH (2016) Complete chloroplast genome sequence of Solanum nigrum and Development of markers for the discrimination of S. nigrum. Hort Environ Biotechnol 57:69-78 Cho K-S, Yun B-K, Yoon Y-H, Hong S-Y, Mekapogu M, Kim
K-H, Yang T-J (2015) Complete chloroplast genome sequence of tartary Buckwheat (Fagopyrum tataricum) and comparative analysis with common Buckwheat (F. esculentum). PloS One 10:e0125332
Chung HJ, Jung JD, Park HW, Kim JH, Cha HW, Min SR, Jeong WJ, Liu JR (2006) The complete chloroplast genome sequences of Solanum tuberosum and comparative analysis with Solanaceae species identified the presence of a 241-bp in cultivated potato chloroplast DNA sequence. Plant Cell Rep 25:1369-1379 Daniell H, Lee S-B, Grevich J, Saski C, Quesada-Vargas T, Guda
C, Tomkins J, Jansen PK (2006) Complete chloroplast genome sequences of Solanum bulbocastanum, Solanum lycopersicum and comparative analyses with other Solanaceae genomes.
Theor Appl Genet 112:1503-1518
Dionne LA (1961) Cytoplasmic sterility in derivatives of Solanum demissum. Am Potato J 38:117-120
Garcia-Lor A, Curk F, Snoussi-Trifa H, Morillon R, Ancillo G, Luro F, Navarro L and Ollitrault P (2013) A nuclear phylogenetic analysis: SNPs, indels and SSRs deliver new insights into the relationships in the ‘true citrus fruit trees’ group (Citrinae, Rutaceae) and the origin of cultivated species. Ann Bot 111:1-19
Gargano D, Vezzi A, Scotti N, Gray JC, Valle G, Grillo S, Cardi T (2005) The complete nucleotide sequence genome of potato (Solanum tuberosum cv. Desiree) chloroplast DNA. In the abstract of the 2nd Solanaceae Genome Workshop, p. 107 Hanneman RE Jr (1994) Assignment of endosperm balance numbers
to the tuber-bearing Solanums and their close non-tuber-bearing relatives. Euphytica 74:19-25
Hawkes JG (1990) The potato: Evolution, biodiversity and genetic resources. Belhaven Press, London, UK
Hosaka K (2002) Distribution of the 241 bp deletion of chloroplast DNA in wild potato species. Am J Potato Res 79:119-123 Hosaka K, Hanneman RE Jr (1988) The origin of the cultivated
tetraploid potato based on chloroplast DNA. Theor Appl Genet 76:172-176
Hosaka K, Sanetomo R (2012) Development of a rapid identification method for potato cytoplasm and its use for evaluating Japanese collections. Theor Appl Genet 125:1237-1251 Jheng C-F, Chen T-C, Lin J-Y, Chen T-C, Wu W-L, Chang C-C
(2012) The comparative chloroplast genomic analysis of photosynthetic orchids and developing DNA markers to
distinguish Phalaenopsis orchids. Plant Sci 190:62-73 Johnston SA, Hanneman RE Jr (1980) Support of the endosperm
balance number hypothesis utilizing some tuber-bearing Solanum species. Am Potato J 57:7-14
Kim S, Cho K-S, Park T-H (2018) Development of PCR-based markers for discriminating Solanum berthaultii using its complete chloroplast genome species. J Plant Biotechnol 45:207-216
Kim K, Lee SC, Lee J, Lee HO, Joh HJ, Kim NH, Park HS, Yang TJ (2015) Comprehensive survey of genetic diversity in chloroplast genomes and 45S nrDNAs within Panax ginseng species. PLoS One 10:e0117159
Kim S, Park T-H (2019) PCR-based markers developed by comparison of complete chloroplast genome sequences discriminate Solanum chacoense from other Solanum species.
J Plant Bioechnol 46:79-87
Kim S, Park T-H (2020a) Comparison of the complete chloroplast genome sequences of Solanum stoloniferum with other Solanum species generate PCR-based markers specific for Solanum stoloniferum. J Plant Bioechnol 47:131-140 Kim S, Park T-H (2020b) Development of Solanum hougasii-specific
markers using the complete chloroplast genome sequences of Solanum species. J Plant Bioechnol 47: 141-149
Kurtz S, Phillippy A, Delcher AL, Smoot M, Shumway M, Antonescu C, Salzberg SL (2004) Versatile and open software for comparing large genomes. Genome Biol 5:R12
Lohse M, Drechsel O, Kahlau S, Bock R (2013) Organellar GenomeDRAW – a suite of tools for generating physical maps of plastid and mitochondrial genomes and visualizing expression data sets. Nucleic Acids Res 41:W575-W581 Lössl A, Götz A, Braun A, Wenzel G (2000) Molecular markers for
cytoplasm in potato: male sterility and contribution of different plastid-mitochondrial configurations to starch production.
Euphytica 116:221-230
Mohapatra T, Kirti PB, Dinesh Kumar V, Prakash S, Chopra VL (1998) Random chloroplast segregation and mitochondrial genome recombination in somatic hybrid plants of Diplotaxis catholica + Brassica juncea. Plant Cell Rep 17:814-818 Ono S, Sanetomo R, Hosaka K (2016) Genetic transmission of
Solanum demissum (2n=6x=72) chromosomes from a pentaploid hybrid of S. tuberosum (2n=4x=48) into aneuploidy BC1 progeny.
Euphytica 207:149-168
Ortiz R, Ehlenfeldt MK (1992) The importance of endorsperm balance number in potato breeding and the evolution of tuber-bearing Solanum species. Euphytica 60:105-113
Palmer JD (1991) Plastid chromosomes: structure and evolution, p.
5-53. In: L. Bogorad, K. Vasil (eds.) The molecular biology of plastids. Academic Press, San Diego, USA
Park T-H (2017) The complete chloroplast genome of Solanum berthaultii, one of the potato wild relative species. Mitochondr DNA Part B 2:88-89
Park T-H, Vleeshouwers VGAA, Jacobsen E, van der Vossen E, Visser RGF (2009) Molecular breeding for resistance to Phytophthora infestans (Mont) de Bary in potato (Solanum tuberosum L.): a perspective of cisgenesis. Plant Breed 128:109-117
Pendinen G, Spooner DM, Jiang J, Gavrilenko T (2012) Genomic in situ hybridization reveals both auto- and allopolyploid origins of different North and Central American hexaploid potato (Solanum sect. Petota) species. Genome 55:407-415 Plastided RL, Hoopes RW (1989) The past record and future
prospects for the use of exotic potato germplasm. Am Potato J 66:603-627
Ross H (1986) Potato breeding: problems and perspectives. Verlag Paul Parey, Berlin and Hamburg, Germany
Raubeson LA, Jansen RK (2005) Chloroplast genomes of plants, p.
45-68. In: H. Henry (ed.) Diversity and evolution of plants:
genotypic and phenotypic variation in higher plants. CABI Publishing, Wallingford, UK
Ruiz ON, Daniell H (2005) Engineering cytoplasmic male sterility via the chloroplast genome. Plant Physiol 138:1232-1246 Sanetomo R, Ono S, Hosaka K (2011) Characterization of
crossability in the crosses between Solanum demissum and S.
tuberosum, and the F1 and BC1 progenies. Am J Potato Res 88:500-510
Saski C, Lee SB, Daniell H, Wood TC, Tomkins J, Kim HG, Jansen RK (2005) Complete chloroplast genome sequence of Glycine max and comparative analyses with other legume genomes.
Plant Mol Biol 59:309-322
Schwartz S, Kent WJ, Smit A, Zhang Z, Baertsch R, Hardison RC, Haussler D, Miller W (2003) Human-mouse alignments with BLASTZ. Genome Res 13:103-107
Spooner DM, Ghislain M, Simon R, Jansky SH, Gavrilenko T (2014) Systematics, diversity, genetics, and evolution of wild
and cultivated potatoes. Bot Rev 80:283-383
Spooner DM, Rodríguez F, Polgár Z, Ballard HE, Jr, Jansky SH (2008) Genomic origins of potato polyploids: GBSSI gene sequencing data. Crop Sci 48:527-536
Sugiura M, Hirose T, Sugita M (1998) Evolution and mechanism of translation in chloroplast. Annu Rev Genet 32:437-459 Symda-Dajmund P, Śliwka J, Wasilewicz-Flis I, Jakuczun H,
Zimnoch-Guzowska E (2016) Genetic composition of interspecific potato somatic hybrids and autofused 4x plants evaluated by DArT and cytoplasmic DNA markers. Plant Cell Rep 35:
1345-1358
Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: molecular evolutionary genetic analysis version 6.0. Mol Biol Evol 30:2725-2729
Tillich M, Lehwark P, Pellizzer T, Ulbricht-Jones ES, Fischer A, Bock R, Greiner S. (2017) GeSeq – versatile and accurate annotation of organelle genomes. Nucleic Acids Res 45:W6-W11
Xiang F, Xia G, Zhi D, Wang J, Nie H, Chen H (2004) Regeneration of somatic hybrids in relation to the nuclear and cytoplasmic genomes of wheat and Setaria italica. Genome 47:680-688 Yamaki S, Ohyangi H, Yamasaki M, Eiguchi M, Miyabayashi T,
Kubo T, Kurata N and Nonomura K (2013) Development of INDEL markers to discriminate all genome types rapidly in the genus Oryza. Breeding Sci 63:246-254
Yurina NP, Odintsova MS (1998) Comparative structural organization of plant chloroplast and mitochondrial genomes.
Russ J Genet 34:5-22