Astrocytes down-regulate microglial inflammatory responses

Astrocytes에 의한

의

염증반응 조절 연구

Astrocytes down-regulate

microglial inflammatory responses

by

Jong Hyeon Kim

A Dissertation Submitted to The Graduate School of Ajou University

in Partial Fulfillment of the Requirements for the Degree of

MASTER OF MEDICAL SCIENCES

Supervised by

Eun Hye Joe, Ph.D.

Department of Medical Sciences

The Graduate School, Ajou University

김종현의 이학 석사학위 논문을 인준함.

심사위원장 주 일 로 인

심 사 위 원 조 은 혜 인

심 사 위 원 박 상 면 인

아 주 대 학 교 대 학 원

2008년 6월 23일

- ABSTRACT -

Astrocytes down-regulate microglial inflammatory responses

Microglia, the major inflammatory cells in the brain, are activated in injured brain and produce several inflammatory mediators. Previously, it has been reported that soluble factors from cultured astrocytes are capable of suppressing microglial activation. However, brain injury affect not only microglia but astrocytes. Therefore, I examined how astrocytes in injury states modulate microglial activation. Astrocytes were treated with oxygen-glucose deprivation (OGD) or hydrogen peroxide (H2O2, 0.01-1 mM), and culture conditioned media

(OGD-ACM or H2O2-ACM) were collected. Both OGD-ACM and H2O2-ACM collected

within 3 h after the treatment strongly reduced iNOS, COX-2, TNF-alpha, and IL-6 in interferon-γ (IFN-γ)-activated microglia. However, OGD-ACM collected from dead astrocytes at 24 h after the treatment did not reduce IFN-γ-induced iNOS expression. OGD-ACM inhibited microglial activation via direct suppression of IFN-γ-signaling without protein synthesis such as HO-1 or SOCS. The target regulated by OGD-ACM appeared to be in the nucleus since OGD-ACM did not inhibit phosphorylation and translocation from the cytosol to the nucleus of STAT 1/3 but reduced GAS-promoter activity. Taken together, these results suggest that

astrocytes in injured brain suppress microglial activation to prevent severe inflammation and inflammation-induced secondary damage.

TABLE OF CONTENTS

ABSTRACT --- i

TABLE OF CONTENTS --- iii

LIST OF FIGURES --- v

LIST OF TABLES --- vi

. INTRODUCTION Ⅰ --- 1

A. Microglia and brain inflammation --- 1

B. Positive and negative regulation of microglial activation --- 1

C. Specific aims of this study --- 3

. MATERIALS AND METHODS Ⅱ --- 5 A. MATERIALS --- 5 B. METHODS --- 5 1. Cell culture --- 5 2. Preparation of OGD-ACM --- 6 3. Reverse transcription-PCR --- 6

4. Western blot analysis --- 7

5. Measurement of NO Release --- 8

6. Plasmids --- 8

8. Nuclear fractionation --- 9

9. Live/dead viability assay --- 10

. Ⅲ RESULTS--- 11

A. Astrocytes treated with oxygen-glucose deprivation (OGD) reduc iNOS expression in IFN-γ-treated BV2 microglia. --- 11

B. OGD-ACM reduces expression of pro-inflammatory mediators in primary cultured microglia. --- 13

C. The extent of damage determines anti-inflammatory effect of astrocytes. --- 15

D. OGD-ACM directly reduces iNOS expression without induction of protein expression. --- 19

E. OGD-ACM reduces GAS-promoter activity without inhibition of STAT-1/3 activation. --- 21 . DISCUSSION Ⅳ --- 26 V. CONCLUSION --- 30 REFERENCES --- 32 국문요약 --- 42

LIST OF FIGURES

Fig. 1. Effect of conditioned media prepared from OGD-treated astrocytes

on microglial activation. --- 12 Fig. 2. OGD-ACM reduces expression of pro-inflammatory mediators in

IFN-γ-activated microglia. --- 14 Fig. 3. The anti-inflammatory effect of OGD-ACM prepared at different times

after OGD treatment. --- 16 Fig. 4. Anti-inflammatory effect of H2O2-ACM. --- 18

Fig. 5. The effect of OGD-ACM was not related to protein induction. --- 20 Fig. 6. Effect of OGD-ACM on STAT-1/3 phosphorylation in IFN-γ-

activated microglia. --- 23 Fig. 7. OGD-ACM dose not inhibit STAT translocation from the cytosol to

the nuclei in IFN-γ-activated microglia. --- 24 Fig. 8. OGD-ACM inhibits GAS-promoter activity in IFN-γ-activated microglia.

LIST OF TABLES

TABLE 1. Primers for iNOS, COX-2, TNF-a, IL-6, HO-1, SOCS-1/3

Ⅰ.

INTRODUCTION

A. Microglia and brain inflammation

Microglia are major immune effector cells in the central nervous system. Microglia are activated in response to brain injury, and express inflammatory mediators such as inducible nitric-oxide synthase (iNOS), tumor necrosis factor-alpha (TNF-α) and prostaglandins (Woodroofe et al., 1986; Giulian et al., 1991; Morioka et al., 1993). Microglial activation is a defense mechanism that protects brain from further infection but aggravates acute brain injury, and also affects the onset and progression of several neurodegenerative disorders such as Alzheimer’s disease, Parkinson’s disease, and multiple sclerosis (Gonzalez-Scarano and Baltuch, 1999; Vila et al., 2001; Sanders and De Keyser, 2007). Therefore, the brain should tightly regulate the duration and extent of microglial activation.

B. Positive and negative regulation of microglial activation

Microglia are activated by several stimulators such as LPS, beta-amyloid, ganglioside, thrombin, and interferon-gamma (IFN-γ) etc (Meda et al., 1995; Minghetti et al., 1998; Pyo et al., 1998; Pyo et al., 1999; Ryu et al., 2000; Kang et al., 2001). These stimulators activate microglia through the activation of mitogen activated protein kinase (MAPK) and JAK/STAT signaling pathways (Pyo et al.,

1998; Pyo et al., 1999; Ryu et al., 2000; Kang et al., 2001). Microglial activators such as LPS, thrombin, and gangliosides activate MAPK pathways and inhibitors of these pathways suppress microglial activation (Pyo et al., 1998; Pyo et al., 1999; Ryu et al., 2000). IFN-γ and gangliosides also activate microglia through the activation of JAK/STAT pathways (Kim et al., 2002; Kim et al., 2003). These microglial activators phosphorylate JAK, which subsequently phosphorylates STATs (Greenlund et al., 1995; Kim et al., 2002). The phosphorylated STATs form dimer, translocate to the nucleus, and bind to the IFN-γ-activated site (GAS) in the promoter of IFN-γ-induced genes (Sims et al., 1993; Caldenhoven et al., 1994).

In addition to these activation processes, diverse mechanisms down-regulate microglial activation. The suppressors of cytokine signaling (SOCS) is a well known negative regulator of JAK/STAT pathway. SOCS family proteins contain a central SH2 domain, a conserved SOCS box in the C-terminus, and a unique N-terminus. CIS and SOCS1~7 have been identified. SOCS proteins directly interact with the JAK family and inhibit their catalytic activity or interact with phosphorylated tyrosine residues in the cytoplasmic domains of cytokine receptor (Yasukawa et al., 2000; Alexander, 2002; O’shea et al., 2002). 1 and SOCS-3 play significant roles in the regulation of inflammation (Suzuki et al., 2001; Federici et al., 2002). SOCS-1 and 3 inhibit activation of STAT-1/3 and suppress IFN-γ-induced expression of ICAM-1, MCP-1 and IFN-γ-inducible protein-10

(IP-10). Protein inhibitor of activated STAT (PIAS) is another negative regulator of JAK/STAT pathway. Previous reported that PIAS inhibits STAT-mediated gene expression (Liu et al., 1998; Rogers et al., 2003; Ungureanu et al., 2003). The mammalian PIAS family consists of PIAS1, PIAS3, PIASx and PIASy (Shuai, 1999; Shuai and Liu, 2003). PIAS might regulate JAK/STAT pathways through several mechanisms: by blocking DNA-binding activity of a transcription factor, by blocking recruiting other co-regulators, by promoting the sumoylation of a transcription factor, or by sequestering transcription factors to co-repressor complexes (Shuai, 2006; Liu et al., 1998; Rogers et al., 2003; Ungureanu et al., 2003).

Studies have shown that a number of cell types act in concert to regulate inflammation via cell-cell interaction. In the brain, the highly abundant astrocytes regulate microglial inflammatory responses. Astrocytes suppress the expression of IL-12 and iNOS in activated microglia (Vincent et al., 1997; Aloisi et al., 1997; Pyo et al., 2003; Min et al., 2006). Recent studies in our lab showed that astrocytes exert this anti-inflammatory effect through the expression of antioxidant enzymes such as heme oxygenase-1 (Min et al., 2006).

C. Specific aims of this study

inflammatory mediators and that astrocytes down regulate microglial inflammatory responses. However, in injured brain astrocytes are also influenced by the injury. And it has not been studied how astrocytes in injured state modulate microglial inflammatory responses.

The specific aims of this study are to reveal how and by what injured astrocytes modulate microglial inflammatory responses.

To examine this issue, I examined the effect conditioned media obtained from astrocytes damaged by oxygen-glucose deprivation (OGD) and hydrogen peroxide (H2O2) on expression of iNOS and proinflammatory cytokines and JAK/STAT

Ⅱ. MATERIAL AND METHODS

A. Materials.

Interferon-γ was purchased from Peprotech (Rocky Hill, NJ). H2O2 was

purchase from Duksan Pure Chemical (Ansan, Korea). Cycloheximide was purchase from Calbiochem (Darmstadt, Germany). PCR primers were obtained from Bioneer (Daejeon, Korea). Live/dead viability/cytotoxicity kit was purched from Invitrogen (Carlsbad, CA). The others were purchased from Sigma (St. Louis, MO).

B. Methods

1. Cell culture

Primary microglia were cultured from the cerebral cortices of 1d-old Sprague Dawley rats as described previously (Giulian and Baker, 1986; Pyo et al., 1998). Briefly, cortices were triturated into single cells in minimal essential media (MEM) (Sigma) containing 10% fetal bovine serum (FBS) (JBI, Taegu, Korea), plated in 75 cm2 _{T-flasks (0.5 hemisphere/flask), and incubated for 2 weeks at 37°C in an}

atmosphere of 5% CO2 in air. Microglia were detached from the flasks by mild shaking and filtered through a nylon mesh to remove astrocytes and cell clumps. Microglia were cultured in MEM containing 5% FBS. Primary astrocytes

remaining in the flask were harvested with 0.1% trypsin. Astrocytes were plated in 100 mm dishes and cultured in MEM supplemented with 10% FBS. BV2 cells (murine microglial cells) were cultured in DMEM (Invitrogen, Carlsbad, CA) supplemented with 5% FBS.

2. Preparation of OGD-treated ACM

Astrocytes were grown to confluence. On reaching confluence, cells were washed thrice with phosphate-buffered saline (PBS). After that, culture media were changed with DMEM (Invitrogen, Carlsbad, CA), had been saturated with N2 gas

for 1h, without FBS and glucose, and then transferred into an anaerobic chamber (Forma Scientific, Marietta, OH, USA) maintained at 37°C with a humidified atmosphere of 5% CO2, 10% H2 and 85% N2 (Kim et al., 2003). OGD-ACM was

collected at 5 min, 3 h and 24 h after the transferred and stored at -70°C until use. The anaerobic environment inside the chamber was monitored with diluted methylene blue solution as an O2 indicator before and during experiments.

3. Reverse transcription-PCR

Total RNA was isolated using RNAzol B (iNtRON, Sungnam, Korea), and cDNA was prepared using the Avian Myeloblastosis Virus reverse transcriptase (Promega, Madison, WI), according to the instructions of the manufacturer.

Reverse transcription (RT)-PCR was performed using primers specific for the pro-inflammatory mediators, SOCS-1/3, HO-1 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) genes (Table 1). The amplified products were separated by electrophoresis on a 1.5% agarose gel and detected under UV light.

5’- ACAACCTTGGTGTTGAAGGC 5’- GAAGGGACACCCTTTCACAT 5’- CCCTTCTCCAGCTGGGAGAC 5’- GGTTTGCCGAGTAGACCTCA 5’- TTGAGCAGGAAGGCGGTCTTAG 5’- AGCAGCTCGAAAAGGCAGTC 5’- GTGGAGCATCATACTGATCC 5’- AGATCCACAACGGATACATT 5’- GCAGAATGTGACCATCATGG 5’- ACACTCTATCACTGGCATCC 5’- GTAGCCCACGTCGTAGCAAA 5’- AAAATCTGCTCTGGTCTTCTGG 5’- ACTTTCAGAAGGGTCAGGTGTCC 5’- ACACTCACTTCCGCACCTTC 5’- ACCAGCGCCACTTCTTCACG 5’- TCCCTCAAGATTGTCAGCAA Rat iNOS Rat COX-2 Rat TNF-α Rat IL-6 Rat HO-1 Mouse SOCS-1 Mouse SOCS-3 Rat GAPDH Antisense Sense

TABLE 1. Primers for iNOS, COX-2, TNF-a, IL-6, HO-1, SOCS-1/3 and GAPDH.

5’- ACAACCTTGGTGTTGAAGGC 5’- GAAGGGACACCCTTTCACAT 5’- CCCTTCTCCAGCTGGGAGAC 5’- GGTTTGCCGAGTAGACCTCA 5’- TTGAGCAGGAAGGCGGTCTTAG 5’- AGCAGCTCGAAAAGGCAGTC 5’- GTGGAGCATCATACTGATCC 5’- AGATCCACAACGGATACATT 5’- GCAGAATGTGACCATCATGG 5’- ACACTCTATCACTGGCATCC 5’- GTAGCCCACGTCGTAGCAAA 5’- AAAATCTGCTCTGGTCTTCTGG 5’- ACTTTCAGAAGGGTCAGGTGTCC 5’- ACACTCACTTCCGCACCTTC 5’- ACCAGCGCCACTTCTTCACG 5’- TCCCTCAAGATTGTCAGCAA Rat iNOS Rat COX-2 Rat TNF-α Rat IL-6 Rat HO-1 Mouse SOCS-1 Mouse SOCS-3 Rat GAPDH Antisense Sense

TABLE 1. Primers for iNOS, COX-2, TNF-a, IL-6, HO-1, SOCS-1/3 and GAPDH.

4. Western blot analysis

Cells were washed twice with cold PBS and lysed on ice in modified radioimmunoprecipitation assay buffer (50 mM Tris-HCl, pH 7.4, 1% NP-40, 0.25% Nadeoxycholate, 150 mM NaCl, 1 mM Na3VO4, and 1 mM NaF) containing

protease inhibitors [2 mM phenylmethylsulfonyl fluoride (PMSF), 10 μg/ml leupeptin, 10 μg/ml pepstatin, and 2 mM EDTA]. Each lysate was centrifuged at 12,000 rpm for 15 min at 4°C, and the supernatants were collected. Proteins were separated by SDS-PAGE and transferred to a nitrocellulose membrane. The

membrane was incubated with antibodies against iNOS (Upstate Biotechnology, Lake Placid, NY), HO-1 (Stressgen Biotechnologies, Victoria, British Columbia, Canada), pTyr-STAT 1 (Cell Signaling Technology), pTyr-STAT 3 (Upstate Biotechnology, Lake Placid, NY) or actin (Santa Cruz Biotechnology), followed by incubation with peroxidaseconjugated secondary antibodies (Zymed, San Francisco, CA) and visualization using an enhanced chemiluminescence system.

5. Measurement of NO Release

Media nitrite concentration was measured as an indication of NO release. Following the indicated cell incubations, 50 μl of culture medium was removed and mixed with an equal volume of Griess reagent (0.1% naphthylethylenediamine, 1% sulfanilamide, 2.5% H3PO4). The optical density was measured at 540 nm

(Ding et al., 1988).

6. Plasmids

The 8-GAS luciferase reporter construct was a gift from Dr. M.-h. Shong (Chungnam National University, Daejon, Korea).

7. Transient transfection and luciferase assays

before transfection, BV2 cells were plated to maintain ~60–80% confluence. The cells were transiently transfected with the plasmid 8-GAS luciferase reporter constructs (2μg) and pCMV-β-GAL constructs (0.2μg) using Lipofectamine Plus reagents and Lipofectamine as instructed by the manufacturer (Invitrogen). Overnight after transfection, cells were treated with 20 U/ml IFN-γ for 3h in the absence or presence of OGD-ACM. Luciferase assay was performed according to the instructions of the manufacturer (Promega). The relative luciferase units were corrected for relative expression of β-galactosidase.

8. nuclear fractionation

Cells were washed twice with cold PBS, lysed on ice in modified buffer A (10 mM HEPES, pH 7.9, 10 mM KCl) containing protease inhibitors [0.5 mM PMSF, 1 mM DTT, and 0.1 mM EDTA] for 15min after vortexing. Each lysate were vortexed at 10 sec after added 10 % NP-40 (25 μl), centrifuged at 13,000 rpm for 2 min at 4°C, and the supernatants were collected. One more time, Each pellets were lysed on ice in modified buffer A (10 mM HEPES, pH 7.9, 10 mM KCl) containing protease inhibitors [0.5 mM PMSF, 1 mM DTT, and 0.1 mM EDTA] for 15min after vortexing. Each lysate were vortexed at 10 sec after added 10 % NP-40 (25 μl), centrifuged at 13,000 rpm for 2 min at 4°C. And the supernatants were removed. Each Pellet were vortexed in buffer B (20 mM HEPES, pH 7.9, 0.4 M

NaCl) containing protease inhibitors [0.5 mM PMSF, 1 mM DTT, and 1 mM EDTA] for 2 min, and lysed on ice. Each lysate centrifuged at 13,000 rpm for 2 min at 4°C, and the supernatants were collected. Proteins were separated by SDS-PAGE and transferred to a nitrocellulose membrane. The membrane was incubated with antibodies against pTyr-STAT 1 (Cell Signaling Technology), pTyr-STAT 3 (Upstate Biotechnology, Lake Placid, NY) or actin (Santa Cruz Biotechnology), followed by incubation with peroxidaseconjugated secondary antibodies (Zymed, San Francisco, CA) and visualization using an enhanced chemiluminescence system.

9. Live/dead viability assay

Astrocytes were grown to confluence. Astrocytes were treated with OGD for 3h, and 24h, and then treated with live/dead assay reagents, consist of 4 μM EthD-1 (ethidium homodimer-1) and 2 μM calcein AM mixed solution, for 30 min at room temperature. View the labeled cells under the fluorescence microscope.

Ⅲ.

RESULTS

A. Astrocytes treated with oxygen-glucose deprivation (OGD) reduce iNOS expression in IFN-γ-treated BV2 microglia.

Previously, it has been reported that in ischemic brain and LPS-injected brain, microglia do not express iNOS (Ji et al., 2007). In this study I examined the effect of astrocytes in injury states on microglial activation since astrocytes are also damaged in injured brain.

For this, astrocytes were treated for 3 h with oxygen-glucose deprivation (OGD), a condition that mimics ischemia. Then I examined the effect of soluble factor(s) in the culture conditioned media produced by OGD-treated astrocytes (OGD-ACM) on microglial activation. Interestingly, OGD-ACM significantly reduced iNOS expression in BV2 microglia treated with interferon-gamma (IFN-γ) for 12 h while ACM prepared from astrocytes cultured in normoxic and glucose-containing media did not reduce IFN-γ−induced iNOS expression (Fig. 1A). In addition, the levels of NO production in the media were also reduced in OGD-ACM-treated cells, as reflected by the amount of nitrite converted from NO in the media (Fig. 1B). These results suggest that astrocytes in injury state exert strong anti-inflammatory effect on microglia through the production of soluble factor(s).

A

*

B

A

*

*

*

B

Fig. 1. Effect of conditioned media prepared from OGD-treated astrocytes on microglial activation. Conditioned media was prepared from astrocytes incubated

for 3 h in normoxic/normal glucose-supplying condition (ACM) or OGD condition. BV2 cells were treated with 20 U/ml IFN-γ for 12h (A) and 48 h (B) in the absence or presence of each conditioned media. iNOS expression was detected by Western blotting. The amounts of nitrite converted from NO in the media were measured by Griess assay (C). * P < 0.01. Data are representative of three independent experiments.

B. OGD-ACM reduces expression of pro-inflammatory mediators in primary cultured microglia.

In primary cultured microglia, IFN-γ-treated microglia led to an increase of iNOS protein from 6 h and RNA from 3h after treatment. And, OGD-ACM significantly reduced IFN-γ-induced iNOS protein/RNA expression (Fig. 2A and B). We also examined whether OGD-ACM could reduce expression of other pro-inflammatory mediators, such as TNF-α, COX-2 and IL-6, in IFN-γ-treated microglia. Similarly, OGD-ACM significantly suppressed expression of these pro-inflammatory mediators (Fig. 2B). These results suggested that OGD-ACM has anti-inflammatory effect that suppresses microglial expression of pro-inflammatory mediators at the transcription level.

B

A

B

A

B

A

Fig. 2. OGD-ACM reduces expression of pro-inflammatory mediators in

IFN-γ-activated microglia. Primary microglia were treated with 20 U/ml IFN-γ for 12h (A) or indicated times (B) in the absence or presence of OGD-ACM. iNOS expression was detected by Western blotting. mRNA expression of pro-inflammatory mediators was detected by RT-PCR. Data are representative of three independent experiments.

C. The extent of damage determines anti-inflammatory effect of astrocytes.

Next, we examined how fast OGD-treated astrocytes exert their anti-inflammatory effect on microglia. Conditioned media was prepared 5 min, 3 h and 24 h after OGD treatment. IFN-γ -induced iNOS expression was significantly reduced in the presence of OGD-ACM collected at 5 min and 3 h (Fig. 3A). However, OGD-ACM collected at 24 h did not reduce microglial iNOS expression (Fig. 3A).

Next, we investigated the reason why OGD-ACM collected at 24 h had no anti-inflammatory effect. The viability of astrocytes treated with OGD was examined using calcein and ethidin-1 that stain live and dead cells, respectively. At 3 h after OGD treatment, most of cells were calcein-positive while at 24 h, almost astrocytes were died and detached from the dish and the cells still attached the dish were ethidin-1-positive (Fig. 3B). These results suggest that astrocytes produce their anti-inflammatory effect on microglia in early injury state (within 5 min). However, astrocytes severely damaged or died by OGD have lost of anti-inflammatory effect.

Fig. 3. The anti-inflammatory effect of OGD-ACM prepared at different times after OGD treatment. (A) OGD-ACM was prepared from astrocytes treated with

OGD for the indicated times. BV2 cells were treated with 20 U/ml IFN-γ for 24 h in the absence or presence of OGD-ACM prepared at the indicated times after OGD treatment. iNOS expression was detected using Western blot. (B) Cells were treated with OGD for 3 or 24 h. The viability of astrocytes was analyzed using calcein and ethidin-1. Data are representative of three independent experiments.

We also investigated whether astrocytes damaged with hydrogen peroxide (H2O2) have anti-inflammatory effect on microglia. Conditioned media was

prepared from astrocytes that were exposed to hydrogen peroxide (0.01, 0.1, or 1 mM) for 1 h, washed out, and then incubated in normal media for 3 h (H2O2-ACM).

H2O2-ACM suppressed iNOS expression in IFN-γ -treated BV2 microglia (Fig.

4A). Interestingly, however, the inhibitory effect of H2O2-ACM obtained at 0.01

mM was stronger than that of H2O2-ACM obtained at 0.1 and 1 mM (Fig. 4A). I

found that 0.01 mM H2O2 had little effect on viability of astrocytes. However, at

0.1 and 1 mM H2O2, the number of ehthidin-1-positive astrocytes increased (Fig.

4B).

Taken together, these results suggest that damage signals no matter of OGD or H2O2 induce secretion of anti-inflammatory factor(s) from astrocytes. Therefore,

astrocytes in injury state could rapidly and strongly suppress microglial inflammatory responses. However, dead astrocytes or deadly injured astrocytes appeared to lose the anti-inflammatory effect.

Fig. 4. Anti-inflammatory effect of H2O2-ACM. (A) BV2 cells were treated with

20 U/ml IFN-γ for 24 h in the absence or presence of H2O2 -ACM. H2O2 -ACM

was prepared from astrocytes treated with hydrogen peroxide (H2O2, 0.01-1 mM)

for 1h, washed with PBS, and then incubated in the normal media for 3 h. iNOS expression was detected by Western blotting. (B) Astrocytes were treated with 0.01-1 mM H2O2 and incubated in the normal media as described in (A). Viability

of astrocytes was analyzed using calcein and ethidin-1. Data are representative of three independent experiments.

D. OGD-ACM directly reduces iNOS expression without induction of protein expression.

Previously, it has been reported that ACM from normal astrocytes induces expression of antioxidant enzymes such as heme oxygenase-1 (HO-1) in microglia, leading to reduction of IFN-γ-induced ROS production and iNOS expression (Min et al., 2006). In this experiment, I examined whether OGD-ACM could function as ACM does. In primary cultured microglia, ACM obtained from astrocytes incubated in the normal media for 3d induced HO-1 expression as previously described. However, OGD-ACM did not induce HO-1 expression (Fig. 5A). I also examined expression of SOCS since SOCS negatively regulates IFN-γ-induced of JAK/STAT pathway (Watling et al., 1993; Wesemann et al., 2002). Although IFN-γ induced SOCS-1 and SOCS-3, OGD-ACM induced neither SOCS-1 nor SOCS-3 in microglia (Fig. 5B). In an agreement with these results, cycloheximide (CHX), an inhibitor of protein synthesis, did not reverse the inhibitory effect of OGD-ACM on iNOS mRNA expression in IFN-γ-treated primary cultured microglia (Fig. 5C). There results indicated that OGD-ACM directly inhibit iNOS expression without protein induction.

Fig. 5. The effect of OGD-ACM was not related to protein induction. (A)

Primary microglia were treated with 20 U/ml IFN-γ for 12 h in the absence or presence of OGD-ACM or ACM. HO-1 expression was detected by Western blot. (B) Cells were treated with 20 U/ml IFN-γ for the indicated times in the absence or presence of OGD-ACM. SOCS-1, 3 expression was detected by RT-PCR. (C) Cells were pre-treated with 100 ng/ml CHX for 30 min, and then treated with 20 U/ml IFN-γ for 3h in the absence or presence of OGD-ACM. Expression of iNOS and TNF-alpha was detected by RT-PCR. Data are representative of three independent experiments.

A

-A

A

B

C

E. OGD-ACM reduces GAS-promoter activity without inhibition of STAT-1/3 activation.

Next, I examined the mechanisms that mediate anti-inflammatory function of OGD-ACM. It is well-known that IFN-γ functions through the activation of JAK/STAT signaling pathways (Silvennoinen et al., 1993; Shuai et al., 1993; Darnell et al., 1994; Greenlund et al., 1995). Since activated STATs are phosphorylated and form homodimers and translocate to the nucleus where they regulate the transcription of IFN-γ-responsive genes (for reviews see Stark et al., 1998; Darnell et al., 1994). Thus, I first examined whether OGD-ACM could regulate STAT-1/3 phosphorylation. In primary cultured microglia treated with IFN-γ, tyrosine phosphorylation of STAT-1/3 reached the peak levels at 30 min, and then decreased. And OGD-ACM did not change the phosphorylation patterns of STAT-1/3 even when the cells were pre-treated with OGD-ACM (Fig. 6A, B).

Next, I examined whether OGD-ACM could regulate translocation of pTyr-STAT-3. In BV2 microglia, IFN-γ led to STAT translocation from 30 min after the treatment. And OGD-ACM did not suppress STAT translocation (Fig. 7).

Since OGD-ACM did not change STAT phosphorylation and translocation, I wondered whether OGD-ACM suppresses IFN-γ-induced production of proinflammatory mediators. Thus, BV2 microglia were transfected with 8-GAS luciferase reporter constructs. GAS-luciferase activity increased within 3 h after

IFN-γ treatment, and OGD-ACM significantly reduced this luciferase activity (Fig. 8). There results collectively suggest that OGD-ACM down-regulate gene expression through the modulation of STAT signaling pathway but at the level down to the STAT translocation into the nucleus.

-½ 1 3 6 -- - - - + + + + ½ 1 3 6 OGD-ACM IFN-γ (h) pY-STAT-1 actin pY-STAT-3 + + + + + + + +

-A

B

-A

B

-A

-A

B

Fig. 6. Effect of OGD-ACM on STAT-1/3 phosphorylation in IFN-γ-activated microglia. (A) Primary microglia were treated with 20 U/ml IFN-γ for the

indicated times in the absence or presence of OGD-ACM. (B) Cells were pretreated (P) with OGD-ACM for the indicated times, and then treated with IFN-γ for 30 min. STAT-1/ 3 activation was detected using p-Tyr specific STAT-1 and STAT-3 antibodies, respectively. Data are representative of three independent experiments.

actin pY-STAT 3 OGD-ACM IFN-γ - + + - - + + -- - + + - - + + Nucleus cytosol actin pY-STAT 3 OGD-ACM IFN-γ - + + - - + + -- - + + - - + + Nucleus cytosol actin pY-STAT 3 OGD-ACM IFN-γ - + + - - + + -- - + + - - + + Nucleus cytosol

Fig. 7. OGD-ACM dose not inhibit STAT translocation from the cytosol to the nuclei in IFN-γ-activated microglia. BV2 cells were treated with 20 U/ml IFN-γ

for 30 min in the absence or presence of OGD-ACM. Localization of phosphorylated STAT-3 was detected using p-Tyr specific STAT-3 antibodies.

IFN-γ OGD-ACM 0 1 2 3 4 5 - + + -- - + +

*

*

GAL constructs (0.2 μg) for overnight. Transfected cells were treated with 20 U/ml IFN-γ for 3h in the absence or presence of OGD-ACM, and then luciferase activity was assayed as described in Materials and Methods. Values are mean ± SEM of three samples and represent relative luciferase activity (RLA). *P<0.01. Data are representative of three independent experiments.

Ⅳ. DISCUSSION

Brain inflammation is the integrated event played by all brain cells. Therefore, it is important to examine the possible interactions between astrocytes and microglia. Previously, it has been reported that astrocyte conditioned-media accumulated for 3 day suppressed IFN-γ-induced microglial inflammatory responses through the induction of HO-1 expression, and consequent reduction of intracellular ROS level. In injured brain, however, not only microglia but also astrocytes were injured. Therefore, I studied the effect of damaged astrocytes on microglial inflammatory responses. To mimic the brain injury, astrocytes were treated with oxygen-glucose deprivation (OGD) or H2O2. I found that soluble

factor(s) from astrocytes treated with OGD or H2O2 suppressed iNOS

expression/NO release in IFN-γ-activated microglia. OGD-ACM also reduced mRNA expression of other pro-inflammatory mediators, such as COX-2, TNF-α and IL-6. There results indicated that the soluble factor(s) from damaged astrocytes could prevent excessive microglial inflammatory responses in injured brain by reducing expression of pro-inflammatory mediators. These results could explain why microglia in ischemic brain did not express iNOS (Matsumoto et al., 2007).

OGD-ACM prepared from mildly damaged astrocytes reduced iNOS expression in IFN-γ-activated microglia, but OGD-ACM prepared from severely

damaged astrocytes did not inhibit iNOS expression. ACM prepared from astrocytes damaged with hydrogen peroxide (H2O2) also suppressed iNOS

expression. Furthermore, astrocytes damaged with low-dose H2O2 exerted more

potent anti-inflammatory effect compared with these cells damaged with high-dose H2O2. Thus, anti-inflammatory effect of damaged astrocytes could be a common

response that occurs in injured brain, and the extent of astrocytes damage but not by the kinds of damage appeared to determine the extent of anti-inflammatory effect.

Previously, it has been reported that ACM accumulated for 3 days from normal healthy astrocytes produced anti-inflammatory effect and that ACM reduced microglial inflammatory responses through the induction of HO-1. However, OGD-ACM accumulated for 3 h had anti-inflammatory effect as potent as ACM accumulated for 3 d had. Furthermore, OGD-ACM directly suppressed microglial iNOS expression without protein synthesis. Although I did not characterize the active factor(s) in the OGD-ACM, in the serial experiments, I found that the factor(s) could be smaller than 3 kDa and relatively heat-resistant. Since the active factor(s) in the ACM was heat-labile and exerted anti-inflammatory effect through the induction of HO-1, the factor(s) from damaged astrocytes appeared to be different from that from normal healthy astrocytes.

function (Silvennoinen et al., 1993; Shuai et al., 1993; Darnell et al., 1994; Greenlund et al., 1995). Indeed, iNOS expression was reduced through the inhibition of JAK/STAT phosphorylation in IFN-γ-activated microglia (Delgado, 2003). Therefore, I examined possible inhibitory effect of OGD-ACM on IFN-γ-induced JAK/STAT activation. However, OGD-ACM neither suppressed STAT phosphorylation nor STAT translocation from cytosol to nucleus. Since OGD-ACM suppressed DNA binding activity of nuclear extracts and GAS-promoter activity in IFN-γ-activated microglia. These results suggest that the target of OGD-ACM in IFN-γ pathway could be in the nucleus in microglia.

SOCS families and PIAS have been reported as negative regulators of JAK/STAT pathways. However, the targets of SOCS are found in the cytosol: SOCS proteins bind to JAKs or cytokine receptors in the cytosol (Yasukawa et al., 2000; Alexander, 2002; O’shea et al., 2002). On the contrary, PIAS inhibits JAK/STAT pathway in the nucleus: PIAS could block DNA-binding of STATs (Shuai, 2006; Liu et al., 1998; Rogers et al., 2003; Ungureanu et al., 2003). Since OGD-ACM did not inhibit STAT translocation but inhibit STAT-DNA binding, OGD-ACM could suppress microglial inflammatory responses through the regulation of PIAS or certain molecules that function similar to PIAS.

V. CONCLUSION

Anti-inflammatory function of damaged astrocytes could be stronger and faster than that of normal healthy astrocytes. Damaged astrocytes secreted anti-inflammatory factor(s) within 5 min. OGD-ACM inhibited expression of IFN-γ-induced inflammatory mediators, such as iNOS, NO, TNF-α, COX-2 and IL-6. OGD-ACM directly inhibited microglial iNOS expression without protein expression whereas normal ACM inhibited microglial activation through the induction of HO-1. OGD-ACM inhibits GAS-promoter activity but not STAT activation and translocation. Probably, anti-inflammatory roles of damaged astrocytes could be a common response in injured brain since ACM from H2O2 –

treated astrocytes exerted similar anti-inflammatory effect. Furthermore, ACM from mildly damaged astrocytes by OGD or H2O2 had anti-inflammatory effect

while ACM from severely damaged astrocytes lost anti-inflammatory effect. Taken together, the results in this study suggest that brain inflammation could be finely controlled in injured brain for prevention of excessive inflammatory responses in injured brain.

REFERENCES

1. Alexander WS. Suppressors of cytokine signalling (SOCS) in the immune system. Nat Rev Immunol. 2: 410-6, 2002

2. Aloisi F, Penna G, Cerase J, Menéndez Iglesias B, Adorini L. IL-12 production by central nervous system microglia is inhibited by astrocytes. J Immunol. 159:

1604-12, 1997

3. Caldenhoven E, Coffer P, Yuan J, Van de Stolpe A, Horn F, Kruijer W, Van der Saag PT. Stimulation of the human intercellular adhesion molecule-1 promoter by interleukin-6 and interferon-gamma involves binding of distinct factors to a palindromic response element. J Biol Chem. 269: 21146-54, 1994

4. Darnell JE Jr, Kerr IM, Stark GR. Jak-STAT pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins. Science. 264: 1415-21, 1994

5. Delgado M. Inhibition of interferon (IFN) gamma-induced Jak-STAT1 activation in microglia by vasoactive intestinal peptide: inhibitory effect on CD40,

IFN-induced protein-10, and inducible nitric-oxide synthase expression. J Biol Chem. 278: 27620-9, 2003

6. Federici M, Giustizieri ML, Scarponi C, Girolomoni G, Albanesi C. Impaired IFN-gamma-dependent inflammatory responses in human keratinocytes overexpressing the suppressor of cytokine signaling 1. J Immunol. 169: 434-42, 2002

7. Giulian D, Baker TJ. Characterization of ameboid microglia isolated from developing mammalian brain. J Neurosci. 6: 2163-78, 1986

8. Giulian D, Johnson B, Krebs JF, George JK, Tapscott M. Microglial mitogens are produced in the developing and injured mammalian brain. J Cell Biol. 112: 323-33, 1991

9. Giulian D, Vaca K. Inflammatory glia mediate delayed neuronal damage after ischemia in the central nervous system. Stroke. 24: 84-90, 1993

10. González-Scarano F, Baltuch G.. Microglia as mediators of inflammatory and degenerative diseases. Annu Rev Neurosci. 22: 219-40, 1999

11. Greenlund AC, Morales MO, Viviano BL, Yan H, Krolewski J, Schreiber RD. Stat recruitment by tyrosine-phosphorylated cytokine receptors: an ordered reversible affinity-driven process. Immunity. 2: 677-87, 1995

12. Holmin S, Mathiesen T, Shetye J, Biberfeld P. Intracerebral inflammatory response to experimental brain contusion. Acta Neurochir (Wien). 132: 110-9, 1995

13. Ji KA, Yang MS, Jeong HK, Min KJ, Kang SH, Jou I, Joe EH. Resident microglia die and infiltrated neutrophils and monocytes become major inflammatory cells in lipopolysaccharide-injected brain. Glia. 55: 1577-88, 2007 14. Kang J, Yang M, Jou I, Joe E. Identification of protein kinase C isoforms

involved in interferon-gamma-induced expression of inducible nitric oxide synthase in murine BV2 microglia. Neurosci Lett. 299: 205-8, 2001

15. Kim HY, Park EJ, Joe EH, Jou I. Curcumin suppresses Janus kinase-STAT inflammatory signaling through activation of Src homology 2 domain-containing tyrosine phosphatase 2 in brain microglia. J Immunol. 171: 6072-9, 2003

16. Kim MH, Jung YS, Moon CH, Jeong EM, Lee SH, Baik EJ, Moon CK. Isoform-specific induction of PKC-epsilon by high glucose protects heart-derived H9c2 cells against hypoxic injury. Biochem Biophys Res Commun. 309: 1-6, 2003

17. Kim OS, Park EJ, Joe EH, Jou I. JAK-STAT signaling mediates gangliosides-induced inflammatory responses in brain microglial cells. J Biol Chem. 277: 40594-601, 2002

18. Liu B, Liao J, Rao X, Kushner SA, Chung CD, Chang DD, Shuai K. Inhibition of Stat1-mediated gene activation by PIAS1. Proc Natl Acad Sci U S A. 95: 10626-31, 1998

19. Lowenstein CJ, Alley EW, Raval P, Snowman AM, Snyder SH, Russell SW, Murphy WJ. Macrophage nitric oxide synthase gene: two upstream regions mediate induction by interferon gamma and lipopolysaccharide. Proc Natl Acad

Sci U S A. 90: 9730-4, 1993

20. Maes M. Evidence for an immune response in major depression: a review and hypothesis. Prog Neuropsychopharmacol Biol Psychiatry. 19: 11-38, 1995

21. Matsumoto H, Kumon Y, Watanabe H, Ohnishi T, Shudou M, Ii C, Takahashi H, Imai Y, Tanaka J. Antibodies to CD11b, CD68, and lectin label neutrophils rather than microglia in traumatic and ischemic brain lesions. J Neurosci Res. 85: 994-1009, 2007.

22. Meda L, Cassatella MA, Szendrei GI, Otvos L Jr, Baron P, Villalba M, Ferrari D, Rossi F. Activation of microglial cells by beta-amyloid protein and interferon-gamma.Nature. 374: 647-50, 1995

23. Min KJ, Yang MS, Kim SU, Jou I, Joe EH. Astrocytes induce hemeoxygenase-1 expression in microglia: a feasible mechanism for preventing excessive brain inflammation. J Neurosci. 26: 1880-7, 2006

24. Morioka T, Kalehua AN, Streit WJ. Characterization of microglial reaction after middle cerebral artery occlusion in rat brain. J Comp Neurol. 327: 123-32, 1993 25. O'Shea JJ, Gadina M, Schreiber RD. Cytokine signaling in 2002: new surprises

in the Jak/Stat pathway. Cell. 109 Suppl:S121-31, 2002

microglia. J Biol Chem. 274: 34584-9, 1999

27. Pyo H, Jou I, Jung S, Hong S, Joe EH. Mitogen-activated protein kinases activated by lipopolysaccharide and beta-amyloid in cultured rat microglia.

Neuroreport. 9: 871-4, 1998

28. Pyo H, Yang MS, Jou I, Joe EH. Wortmannin enhances lipopolysaccharide-induced inducible nitric oxide synthase expression in microglia in the presence of astrocytes in rats. Neurosci Lett. 346: 141-4, 2003

29. Rogers RS, Horvath CM, Matunis MJ. SUMO modification of STAT1 and its role in PIAS-mediated inhibition of gene activation. J Biol Chem. 278: 30091-7, 2003

30. Ryu J, Pyo H, Jou I, Joe E. Thrombin induces NO release from cultured rat microglia via protein kinase C, mitogen-activated protein kinase, and NF-kappa B. J Biol Chem. 275: 29955-9, 2000

31. Sanders P, De Keyser J. Janus faces of microglia in multiple sclerosis. Brain

32. Shuai K. The STAT family of proteins in cytokine signaling. Prog Biophys Mol

Biol. 71: 405-22, 1999

33. Shuai K. Regulation of cytokine signaling pathways by PIAS proteins. Cell Res. 16: 196-202, 2006

34. Shuai K, Liu B. Regulation of JAK-STAT signalling in the immune system. Nat

Rev Immunol. 3: 900-11, 2003

35. Shuai K, Ziemiecki A, Wilks AF, Harpur AG, Sadowski HB, Gilman MZ, Darnell JE. Polypeptide signalling to the nucleus through tyrosine phosphorylation of Jak and Stat proteins. Nature. 366: 580-3, 1993

36. Silvennoinen O, Ihle JN, Schlessinger J, Levy DE. Interferon-induced nuclear signalling by Jak protein tyrosine kinases. Nature. 366: 583-5, 1993

37. Sims SH, Cha Y, Romine MF, Gao PQ, Gottlieb K, Deisseroth AB. A novel interferon-inducible domain: structural and functional analysis of the human interferon regulatory factor 1 gene promoter. Mol Cell Biol. 13: 690-702, 1993

38. Stark GR, Kerr IM, Williams BR, Silverman RH, Schreiber RD. How cells respond to interferons. Annu Rev Biochem. 67: 227-64, 1998

39. Suzuki A, Hanada T, Mitsuyama K, Yoshida T, Kamizono S, Hoshino T, Kubo M, Yamashita A, Okabe M, Takeda K, Akira S, Matsumoto S, Toyonaga A, Sata M, Yoshimura A. CIS3/SOCS3/SSI3 plays a negative regulatory role in STAT3 activation and intestinal inflammation. J Exp Med. 193: 471-81, 2001

40. Ungureanu D, Vanhatupa S, Kotaja N, Yang J, Aittomaki S, Jänne OA, Palvimo JJ, Silvennoinen O. PIAS proteins promote SUMO-1 conjugation to STAT1.

Blood. 102: 3311-3, 2003

41. Vila M, Jackson-Lewis V, Guégan C, Wu DC, Teismann P, Choi DK, Tieu K, Przedborski S. The role of glial cells in Parkinson's disease. Curr Opin Neurol. 14: 483-9, 2001

42. Vincent VA, Tilders FJ, Van Dam AM. Inhibition of endotoxin-induced nitric oxide synthase production in microglial cells by the presence of astroglial cells: a role for transforming growth factor beta. Glia. 19: 190-8, 1997

43. Watling D, Guschin D, Müller M, Silvennoinen O, Witthuhn BA, Quelle FW, Rogers NC, Schindler C, Stark GR, Ihle JN and Kerr IM. Complementation by the protein tyrosine kinase JAK2 of a mutant cell line defective in the interferon-gamma signal transduction pathway. Nature. 366: 166-70, 1993

44. Wesemann DR, Dong Y, O'Keefe GM, Nguyen VT, Benveniste EN. Suppressor of cytokine signaling 1 inhibits cytokine induction of CD40 expression in macrophages. J Immunol. 169: 2354-60, 2002

45. Woodroofe MN, Bellamy AS, Feldmann M, Davison AN, Cuzner ML. Immunocytochemical characterisation of the immune reaction in the central nervous system in multiple sclerosis. Possible role for microglia in lesion growth.

J Neurol Sci. 74: 135-52, 1986

46. Xie QW, Whisnant R, Nathan C. Promoter of the mouse gene encoding calcium-independent nitric oxide synthase confers inducibility by interferon gamma and bacterial lipopolysaccharide. J Exp Med. 177: 1779-84, 1993

47. Yasukawa H, Sasaki A, Yoshimura A. Negative regulation of cytokine signaling pathways. Annu Rev Immunol. 18: 143-64, 2000

- 국문요약 -

Astrocytes에 의한 microglia의 염증반응 조절 연구

얻었다. OGD-ACM 또는 H₂O₂-ACM는 모두 IFN-γ로 활성화시킨 microglia의 iNOS, COX-2, TNF-α　그리고 IL-6 발현을 억제 하였으며, 이러한 효과는 astrocyte가 손상을 받은 후 5분 이내에

나타날 수 있음을 확인하였다. 하지만, OGD를 24시간 처리하여 세포사가 일어난 astrocytes로부터의 OGD-ACM은 IFN-γ에 의한 iNOS 발현을 억제하지 못하였다. OGD-ACM은 IFN-γ에 의해 활성화되는 전사인자인 STAT-1/3의 인산화와 핵으로의 이동을 막지 못하는 반면 STAT의 DNA binding과 GAS-promoter의 활성화를 감소 시켰다. 따라서, OGD-ACM에 의한 microglia의 활성화 억제는 핵 안에서 이루어질 것으로 생각된다. 이러한 결과들은, 상해를 입은 astrocyte가 microglia의 과도한 염증반응을 막음으로써, 염증반응에 의해 유도될 수 있는 신경계의 이차 손상을 억제하는 기전이 될 것으로 생각할 수 있다.

핵심어 : astrocyte, microglia, OGD, iNOS, JAK/STAT pathway, GAS