사료 접종 방법에 의한 in vitro 반추위 발효 상성 변화

www.earticle.net

사료 접종 방법에 의한 in vitro 반추위 발효 상성 변화

유대겸

¹

¹

¹

¹

²

³

^1*

부산대학교 생명자원과학대학 동물생명자원과학과

¹

²

³

Rumen Fermentation was Changed by Feed Inoculation Method in In Vitro

Dae-Kyum Yoo

¹

¹

¹

¹

²

³

¹

1

2

3

ABSTRACT

¹⁾

The objective of this study was to investigate the effect of different feed inoculation method on rumen fermentation in anin vitro. Three experimental treatments were used: control (CON, direct dispersion of feed (2 g) in rumen fluid), combinations of direct dispersion (1 g) and nylon bag (DNB, pore size: 50 μm, 1 g), and nylon bag (NB, 2 g). An in vitro fermentation experiment was carried out using strained rumen fluid for 48 h incubation time and timothy was used as a substrate. At the end of the incubation, in vitro dry matter digestibility (IVDMD), in vitro neutral detergent fiber digestibility (IVNDFD), pH, volatile fatty acids (VFA), ammonia nitrogen (NH

3

3

(Key words: In vitro degradability, Nylon bag, Dispersion, Microbial diversity)

*

Corresponding Author: Jakyeom Seo, Life and Industry Convergence Research Institute, Department of Animal Science, Pusan National University, Miryang, 50463, Republic of Korea. Tel: +82-55-350-5513, Email: [email protected]

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc-nd/3.0/deed.ko), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. The moral rights of the named author(s) have been asserted.

Ⅰ. 서론

반추동물의 사료로 이용되는 원료의 종류는 매우 다양하 며 각각의 원료 사용에 있어 경제적 효율성을 제고하기 위 한 선수 조건은 각 원료에 대해 정확한 영양소 함량을 측

정하는 것이다. 화학적 방법으로 평가된 사료의 영양적 가 치는 실제 동물이 이용할 때 여러 조건에 의해 그 이용성 이 달라질 수 있기 때문에 소화율은 생물학적 방법에 의한 사료의 영양적 가치의 재평가 또한 필요하다(Ha et al., 2005). 생물학적 평가방법 중 in vivo 법은 동물을 직접 사

[Provider:earticle] Download by IP 118.70.52.165 at Monday, December 20, 2021 7:47 PM

www.earticle.net

용하여 소화율 평가함에 따라 가장 정확한 방법으로 인정 되고 있으나 실험 수행에 있어 높은 비용과 노동력을 요한 다는 단점이 있다. 그에 반해 주요 소화기관에 누관이 장 착된 동물을 이용하는 in situ 법과 동물에게서 직접 채취 된 소화액 또는 인공적으로 제조된 유사 소화액을 사용하 는 in vitro 방법은 실험에 필요한 비용과 시간이 적게 들 고, 한 번의 실험에 여러 처리를 통한 차이를 평가할 수 있 으며(Getachew et al., 1998) 동물 복지 측면의 제약이 적다 는 장점을 가지고 있어 축우 사료의 영양적 가치를 평가하 기 위한 방법으로 널리 이용되고 있다(Tagliapietra et al., 2012; Valente et al., 2015).

반추위액을 사용한 in vitro 소화율 실험 시 사용되는 기 질은 일반적으로 특별한 처리 없이 배양병 바닥에 담겨 (Direct dispersion) 반추위액에 직접 접촉될 수 있으며(Fig.

1) 일정 배양 시간이 지난 후 배양병에서 수거되고, 실험자 는 잔량을 측정하여 선택된 사료의 소화율을 계산한다. Dispersion 방법은 사료와 반추위액에 존재하는 미생물과 의 직접적인 접촉을 유도하여 실제 반추위 발효 상황에 가 장 근접한 조건을 조성할 수 있다는 장점이 있으나(Tilley and Terry 1963), 수행자의 숙련도에 따라 사료 손실 정도 의 차이가 있으며 시간과 노동력이 많이 소요된다. 최근에 는 위와 같은 단점을 보완하기 위하여 기질을 배양병에 담 기 전 특정 사료 주머니에 담은 뒤 이를 배양병에 투입하 는 방법이 사용되고 있으며 가장 많이 사용되는 사료 주머 니는 중성세제불용섬유소(neutral detergent fiber, NDF) 분석에서도 사용되는 F57 filter bag(F57, Ankom Technology Corp., Macedon, NY, pore size 25μm) 이나 in situ 실험에서 사용되는 R510 nylon bag(Ankom Technology Corp., Macedon, NY, pore size 50μm)이다 (Fig. 1). 사료 주머니의 사용은 사료를 일정 주머니에 담아 서 배양시키기 때문에 실험자의 숙련도 차이에 따른 사료 소실의 차이를 줄일 수 있을 뿐만 아니라 실험에 소요되는 추가적인 노동과 시간을 절약할 수 있다(Wilman and Adesogan., 2000). 하지만 filter bag을 사용할 경우 filter bag 당 사료를 담을 수 있는 무게가 0.5g으로 제한되기 때 문에(Raffrenato et al., 2018) 사료 첨가제 실험에 제약이 있을 수 있다.

따라서 본 연구의 목적은 in vitro 발효 평가 실험에서 사료 접종 방법이 in vitro 반추위 발효 성상 및 미생물의 조성 변화에 미치는 영향을 평가하여 사료 원료 또는 첨가 제의 효능 평가를 위한 최적의 in vitro 사료 접종 방법을 규명하는데 있다.

Ⅱ. 재료 및 방법

1. 공시재료 및 공시동물

본 연구에서 사용된 원료인 티모시는 국내 배합사료회 사 중 한 곳(Nonghyup Feed Co., Ltd Miryang, Korea)로 부터 제공받았다. 각각의 원료들은 1mm체가 부착된 cyclone mill(Foss, HillerØd, Demark)로 분쇄되었고, 1mm 이하 원료만 공시재료로 이용되었다.

반추위액을 채취하기 위해 사용된 공시동물로서 반추위 캐뉼라가 장착된 거세우 홀스타인 젖소를 이용하였다 (500±30kg, body weight). 사료급여는 6:4의 조농비율로 사 료를 급여하였으며, 조사료원으로는 티모시를 농후사료원 으로 상용 배합사료 12% 조단백질(crude protein, CP), 3.5% 조지방(ether extract, EE), 26% NDF, 10% 조회분 (Ash)를 1일 2회 급여하였다. 또한 음수자동급이기와 미네 랄블록이 구비된 우방(4.7m×8.75m)에서 사육되어 광물질 과 수분을 자율 급여하였다.

2. 영양소 성분분석

공시사료의 영양소 성분분석의 결과는 Table 1에 나타 내었다. 사료의 원료사료 건물(#934.01, dry matter, DM), CP(#976.05), EE(#920.39), 산성세제불용섬유소(#973.18, acid detergent insoluble fiber, ADF), 조회분(ash, #942.05), 칼슘(#927.02, Ca), 인(#3964.06, P)은 AOAC(2005)에 제시 된 방법에 따라 분석되었다. CP는 총 질소 함량의 6.25배 로 계산된 값을 측정하였고, 사료의 총 질소 함량은 Nitrogen Combustion Analyzer(Leco FP-528 Leco, MI, USA)를 이용하여 측정되었다. 섬유소 함량 평가를 위한 NDF와 리그닌(acid detergent lignin, ADL)은 Van Soest 등(1991)에 의해 분석되었으며, NDF 분석을 위해 heat stable α-amylase를 사용하여 분석하고, 잔여 재를 포함하 여 표현하였다.

상기의 분석항목을 이용하여 사료의 에너지가를 가소화 영양소 총량(total digestible nutrients, TDN)으로 평가하 기 위해 NRC 젖소사양표준(2001)을 사용하였고, 비섬유소 탄수화물(non-fibrous carbohydrate, NFC)을 구하기 위해 서는 아래의 수식을 이용하였다.

NFC = [100 – ash – EE – CP – NDF］

[Provider:earticle] Download by IP 118.70.52.165 at Monday, December 20, 2021 7:47 PM

www.earticle.net

Table 1. Estimated chemical composition (%, dry matter basis or as stated) of experimental feeds used for in vitro

Item Composition

DM, % 93.3

CP, %DM 11.5

NDF, %DM 64.4

ADF, %DM 42.6

Lignin, %DM 6.6

EE, %DM 1.68

Ash, %DM 7.69

Ca, %DM 0.2

P, %DM 0.3

NFC, %DM 16.0

TDN

,%DM 54.8

DM, dry matter; CP, crude protein; NDF, neutral detergent fiber analyzed with heat stable α-amylase; ADF, acid detergent fiber; EE, ether extract; NFC, nonfiber carbohydrate; TDN, total digestible nutrients.

1)

The value of TDN was calculated by the methods suggested from NRC (2001)

3.

In vitro

본 연구는 사료 접종 방법이 in vitro 발효 성상에 미치 는 영향을 평가하기 위해 수행되었다. 실험에 사용된 사료 주머니는 상용으로 판매되고 있는 50µm의 공극 크기를 가 진 R510 nylon bag(Ankom Technology Corp., NY, USA) 이 선정되었고 각 처리구의 명칭은 CON(dispersion), DNB(dispersion and nylon bag) 그리고 NB(nylon bag)로 명명하였다. in vitro 발효 시험에 앞서 원료를 CON에는 dispersion 형태로 2g/DM, DNB 처리구는 0.5g/DM씩 담 긴 nylon bag 2개와 dispersion 형태로 1g, NB 처리구는 0.5g/DM씩 담긴 nylon bag 4개를 담은 후 5g의 너트 3개, 2g 너트 1개, 옷핀을 이용하여 고정하였으며 고정시킨 이 유는 사료주머니에 담긴 사료 원료가 사료주머니의 부력 에 의해 반추위액에 뜨는 현상을 방지하기 위함이다. 사료 가 담긴 250mL의 duran bottle은 배양 시험 전까지 bottle 에 보관되었다(Fig. 1). 반추위액은 당일 오전 사료급여 전 공시동물의 반추위 캐뉼라를 통해 채취되었으며, 2L 보온 병에 보관되어 즉시 연구실로 옮겨졌다. 이후 8겹의 cheeze cloth에 걸러진 뒤 1:3의 비율로 in vitro buffer (Goering and Van Soest., 1979)에 희석되었고, O

2

2

에 bubbling시켜 완전 혐기 상태를 유지하였다. 이를 각각 CON과 DNB 그리고 NB 처리구에 140mL씩 분주하고 bottle cap을 이용하여 완전 sealing 처리하였다. sealing된

bottle은 39℃ incubator에서 48h 배양 처리를 거친 다음 개봉되어 건물 소화율, 섬유소 소화율, pH, 암모니아 (NH

3

^®

이후 소화물이 포함된 반추위액은 3,000rpm×15min의 원심분리 과정을 거친 다음, 상등액을 각 1mL씩 NH

3

3

2

4

metaphosphoric acid 200μL를 각각 첨가하여 vortexing 후 –80℃에 냉동 보관하였다. CON 처리구는 Whatman filter paper(Sigma-Aldrich, MO, USA)을 이용하여 잔여물을 여 과하여 55℃ dry oven(LD0-080N, Korea Scientific Instrumnets Industry Cooperative, Namyangju-si, Korea) 에서 48시간 건조하고, 이후 방랭한 뒤 무게를 측정하여 IVDMD(in vitro dry matter degradability)를 측정하였다.

DNB와 NB 처리구는 사료가 담긴 nlyon bag을 증류수를 이용하여 6~7회 깨끗이 씻은 후 55℃ dry oven에서 48시 간 건조 후, 방랭 하여 무게를 측정하여 IVDMD를 계산하 였다(Goering and Van soest., 1979). 섬유소 소화율 평가를 위한 소화물 잔량 내 IVNDFD(in vitro neutral detergent fiber degradability)는 Van Soest 등(1991)이 제시한 방법 으로 분석하였다.

pH는 3,000rpm×15min의 원심분리 과정을 거친 반추위 액을 pH meter(FP20, Mettler toledo, OH, USA)를 이용하 여 측정하였다. NH

3

NH

3

[Provider:earticle] Download by IP 118.70.52.165 at Monday, December 20, 2021 7:47 PM

www.earticle.net

CON DNB NB

Fig. 1. Description of each treatments used in vitro fermentation experiment.

측정하였다.

VFA의 측정은 Erwin 등(1961)이 제시한 방법에 따라 측 정하였다. 보관해둔 sample을 4℃에서 녹이고, 20,000g×

15min의 원심분리과정 후 상층액 200μL를 D.W. 800μL로 희석하여 VFA 분석을 위한 flame ionization detector와 capillary column(Nukol

^TM

/min, hold time 2min), 230℃(rate 20℃/min, hold time 8min)로 유지되었고, 질소는 이동상 gas로 30mL/min의 flow rate를 유지하며 사용되었다.

4. genomic DNA 추출

In vitro 반추위 미생물 평가를 위한 genomic DNA (gDNA) 추출은 1.8mL의 rumen fluid pellet을 이용하여 Sylvester 등(2004)에 의해 제시 repeated bead beating plus column(RBB+C) 방법에 따라 추출하였다. 이를 간략 하게 제시하면, 위액으로부터 얻은 pellet에 lysis buffer(500mM NaCl, 50mM Tris-HCl, pH 8.0, 50mM EDTA, and 4% sodium dodecyl sulfate(SDS)) 1mL을 첨 가한 후 재부유시키고, zirconia beads(BioSpec Products, Inc, OK, USA)가 들어있는 2mL screw-cap tube(Simport

^®

한 번 더 반복하였다.

lysis buffer를 통해 추출된 용액에 260μL의 10M ammonium acetate를 첨가하여 잘 섞은 후 ice에 5분간 incubation을 실시하고, 그 후 4℃에서 16,000g×10min의 원심분리를 실시하였다. 상층액을 2개의 새 2mL tube에 옮긴 후 isopropanol을 첨가하여 30분간 incubation을 실 시하고, incubation 이후 4℃에서 16,000g×15min의 원심분 리를 실시하였다. 상층액을 제거하고 70% ethanol 500μL 로 핵산 pellet을 세척한 후 pellet을 3차 증류수 100μL에 용해시켰다.

RNA와 단백질을 제거하고 DNA를 정제하기 위해 Dokdo-Prep

^™

16,000g×5min의 원심분리 과정을 통해 잔존하는 wash buffer를 완전히 제거하고 pellet을 100μL의 3차 증류수에 용해시켜 gDNA를 얻었다.

5. 재조합 plasmid의 제작

본 연구에 사용된 primer 정보는 Table 2에 제시하였다.

real-time PCR의 정량 기준으로 사용하기 위하여 각 primer의 재조합 DNA를 제작하였다. 반추위액에서 앞서 제시된 방법으로 gDNA 추출하고, 이를 template로 하여

[Provider:earticle] Download by IP 118.70.52.165 at Monday, December 20, 2021 7:47 PM

www.earticle.net

Table 2. PCR primers used in this study

Target specise Primer Sequence Size (bp) Efficiency Reference

General bacteria

F CGGCAACGAGCGCAACCC

130 2.024 [3]

R CCATTGTAGCACGTGTGTAGCC

Protozoa F GCTTTCGWTGGTAGTGTATT

234 1.911 [20]

R CTTGCCCTCYAATCGTWCT

Fungi F GAGGAAGTAAAAGTCGTAACAAGGTTTC

120 1.822 [3]

R CAAATTCACAAAGGGTAGGATGATT

Ruminococcus albus ^F CCCTAAAAGCAGTCTTAGTTCG

176 1.815 [28]

R CCTCCTTGCGGTTAGAACA

Ruminococcus flavefaciens ^F CGAACGGAGATAATTTGAGTTTACTTAGG

132 1.979 [3]

R CGGTCTCTGTATGTTATGAGGTATTACC

Fibrobacter succinogenes

F GTTCGGAATTACTGGGCGTAAA

121 1.854 [3]

R CGCCTGCCCCTGAACTATC

C1000

^™

^™

^™

^™

PCR 산물은 gel extraction kit(LaboPass

^TM

coli(Escherichia coli) DH5α에 형질전환 하였다. 형질전환된 E. coli는 암피실린(50mg/L)이 첨가된 LB(luria-burtani) broth에서 한밤 배양 후, plasmid mini prep kit DokDo- Prep Plasmid Mini-Prep Kit(Elpisbiotech inc., Daejeon, Korea)을 이용하여 완성된 plasmid를 획득하였고, 앞서 제 시된 동일한 조건으로 PCR 검증하여 재조합 primer plasmid를 완성하였다.

6. Real-time PCR

Real-time PCR(polymerase chain reaction)은 CFX96 Touch

^™

Real time PCR의 조성은 최종 반응액 20μL에 0.5μL의 10mM dNTPs Mix(BioFACT

^™

^™

1μL forward primer(10μM), 1μL reverse primer(10μM), 0.2μL Taq polymerase(BioFACT

^™

30초, annealing 60℃ 30초, extension 72℃ 30초 과정을 40 회 반복하였다. 각 cycling 단계에서 evagreen의 형광값을 측정하였고, 40회의 cycling이 완결된 후 60~95℃까지 30 초당 1℃씩 온도를 증가시켜 melting point analysis를 수 행하였고, Ct(threshold cycle)과 Tm 값은 CFX manager software 3.1(Bio-Rad Laboratories, Inc. CA, USA)를 이용 하여 분석하였다. Standard curve는 앞서 제작된 각 재조 합 primer를 1×10

⁵

⁹



_{  }



≤  × 

 ×  ^  ×



아래의 계산식을 이용하여 standard curve의 slope로부 터 PCR 증폭의 efficiency(E)를 계산하였다(Lee et al., 2006).



  ^{ }  

절대 정량은 standard curve에 대한 Ct value를 이용하 여 결정되었고, 사용된 모든 bacteria의 relative abundance 는 general bacteria의 copy number 내의 함량(%)으로 표 현되었다.

[Provider:earticle] Download by IP 118.70.52.165 at Monday, December 20, 2021 7:47 PM

www.earticle.net

Table 3. Gas production and parameters by feed inoculation method

Item Treatment

n SEM P -value

CON DNB NB

Gas (mL/g DM)

3 h 39.36 37.02 36.02 3 1.090 0.05

6 h 61.76

57.94

54.83

3 0.671 <0.01

12 h 96.57

92.60

91.37

3 1.076 <0.01

24 h 169.33

164.80

169.13

3 1.433 <0.05

48 h 283.90 275.13 282.87 3 3.652 0.10

Fitted parameters of gas

V

474.07 464.88 511.93 3 22.933 0.18

K

0.01 0.01 0.01 3 0.001 0.21

SEM, standard error of the mean.

1)

CON, dispersion; DNB, dispersion and nylon bag; NB, nylon bag .

2)

Theoretical maximum gas production (mL/g DM).

3)

Fractional rate of gas production (h

).

a,b

means within a row with different superscript letters indicate significant differences between treatments (p<0.05).

7. Gas parameter

In vitro 분해율은 Schofield 등(1994)에 의해 제시된 simple exponential model을 이용하여 나타내었으며, 식은 아래와 같다. T는 시간(h), L은 지연 시간(h), e는 지수 함 수, K

g

^-1

max

T



_   ≤

≤





_ 

_max ×    ^

^{×   }  

≥



8. 통계 분석

In vitro 실험에서 측정된 모든 data는 SAS package 9.3(SAS Institute Inc., Carey, NC, USA)의 GLM procedure에 의해 분석되었다. 사료 접종 방법에 따른 처 리구 간의 유의적 차이는 Tukey 검정에 의해 5% 유의수준 으로 분석되었다.

Ⅲ. 결과 및 고찰

사료의 접종 방법에 따른 in vitro 발효 성상 차이를 비 교하기 위해 가스 발생량, gas parameter, IVDMD, IVNDFD,

pH, NH

3

In vitro 발효 실험에서 가스 발생량의 측정은 사료의 영 양적 평가와 소화율을 대변할 수 있는 지표로 이용된다 (Sommart et al., 2000; Ki et al., 2017). 본 연구에서 관측된 배양 6, 12h에서의 가스 발생량은 DNB와 NB 처리구에서 CON에 비해 유의적으로 낮은 값이 관찰되었으나(p

<0.01), 배양 24h에서는 DNB 처리구만이 CON에 비해 낮 은 가스 발생량을 보였다(p<0.05). 하지만, 최종 가스 발생 량, 이론적 최대 가스 발생량(V

max

g

max

g

반추위액의 pH는 시료가 반추위 미생물에 의해 발효되 면서 발생하는 여러 발효산물의 축적에 의해 감소한다 (Russell and Hespell., 1981). 본 in vitro 실험결과 관측된 pH 와 총 VFA 발생량 역시 사료 접종 처리에 따른 유의 적 차이가 관측되지 않았고 pH의 경우 모든 처리구에서 6.4 이상이었으므로, 미생물의 섬유소 분해 능력에 영향을 주지 않았을 것으로 사료된다(Russell and Wilson., 1996).

VFA 조성 또한 처리구 간의 유의적인 차이가 없었는데 위

[Provider:earticle] Download by IP 118.70.52.165 at Monday, December 20, 2021 7:47 PM

www.earticle.net

Table 4. Fermentation characteristics after in vitro incubation using strained rumen fluid

Item Treatment

n SEM P -value

CON DNB NB

pH 6.47 6.49 6.49 3 0.023 0.55

NH

-N, mg/100mL 43.69 43.64 45.71 3 1.727 0.44

Total VFA, mmol/mol 80.71 83.34 86.09 3 3.939 0.44

Acetate, mmol/mol 555.63 558.30 558.03 3 5.478 0.87

Propionate, mmol/mol 201.00 197.33 201.00 3 2.018 0.19

Butyrate, mmol/mol 132.67 133.33 130.67 3 1.578 0.48

A:P ratio 2.76 2.83 2.77 3 0.032 0.33

IVDMD, % 44.87

56.04

58.55

3 1.989 <0.01

IVNDFD, %NDF 53.40 48.30 50.67 3 2.865 0.28

NH

-N,ammonia nitrogen; VFA, volatile fatty acid; A : P ratio, acetate to propionate ratio; IVDMD, in vitro dry matter degradability;

IVNDFD, in vitro neutral detergent fiber degradability; SEM, standard error of the mean.

1)

CON, dispersion; DNB, dispersion and nylon bag; NB, nylon bag.

a,b

means within a row with different superscript letters indicate significant differences between treatments (p<0.05).

와 같은 측정결과는 가스 발생량에서 사료 접종 방법에 따 른 차이가 없었다는 결과와 일치한다. NH

3

3

3

의 반추위액 상층부 머무름 현상이 in vitro 발효에 미치는 영향은 미미할 것으로 사료된다. 따라서 사료 주머니 사용 에 의한 IVDMD의 증가 결과는 배양 후 세척 과정에서 dispersion에 비해 미소화 사료입자의 유실이 높아서 발생 한 결과로 보이며, 본 실험에서는 25µm의 공극 크기를 가 진 filter bag 보다 공극 크기가 큰 50µm의 공극 크기를 가 진 nylon bag을 사용하였기 때문에 세척에 의한 영양소 소 실이 높을 것이라고 추측된다(Lindberg and Kuntsson., 1981).

반추위액 내 주요 미생물과 주요 섬유소 박테리아의 우 점도를 측정한 값은 Table 5에 나타내었다. Wilman과 Adesogan(2000)과 Ellis 등 (1994)의 연구에서 filter bag의 공극 크기(25μm)는 사료 주머니 내부로 미생물이 유입되 는 것을 저해하지 않는 충분한 크기이므로 미생물의 유입 을 방해 하지 않는다고 보고 하였다. 선행연구의 결과와 유사하게, 본 연구에 이용된 사료주머니 처리는 박테리아와 곰팡이의 우점도에 유의적 영향을 주지 않았다. 본 연구에 서 in vitro 배양 이후 Real time PCR을 수행하기 위해 앞서 표기한 섬유소 박테리아를 선정한 이유는, Ruminococcus albus, Ruminococcus flavefaciens, 그리고 Fibrobacter succinogenes는 반추위 섬유소 분해 박테리아 중 각각 46.0%, 2.6%, 그리고 33.0%를 차지하는 주요 미생물로 보 고된 바 있기 때문이다(Russell and Wilson., 1996). 본 연 구결과에 따르면, 사료 주머니의 이용은 사료 밀착 미생물 로 분류되는 Ruminococcus albus의 수에는 부정적인 영향 을 미치지 않았으나, 사료 부착 미생물인 Ruminococcus flavefaciens, Fibrobacter succinogenes에 유의적인 영향을 줄

[Provider:earticle] Download by IP 118.70.52.165 at Monday, December 20, 2021 7:47 PM

www.earticle.net

Table 5. Rumen microbial population after in vitro incubation using strained rumen fluid

Item Treatment

n SEM P- value

CON DNB NB

Organism

General bacteria

2.54 2.27 2.54 3 0.468 0.80

Protozoa

1.60

1.51

2.51

3 0.231 <0.01

Fungi

8.60 8.45 8.02 3 0.653 0.65

Relative abundance (% General bacteria)

Ruminococcus albus 10.52 10.29 13.47 3 2.008 0.23

Ruminococcus flavefaciens 3.22

1.83

2.01

3 0.443 <0.01

Fibrobacter succinogenes 4.97

3.25

2.12

3 0.651 <0.01

SEM, standard error of the mean.

1)

CON, dispersion; DNB, dispersion and nylon bag; NB, nylon bag.

a,b

means within a row with different superscript letters indicate significant differences between treatments (p<0.05).

2)

× 10

copy number of the 16S rDNA gene per gram of rumen content.

3)

× 10

copy number of the 18S rDNA gene per gram of rumen content.

4)

× 10

copy number of the 18S rDNA gene per gram of rumen content.

수 있음이 확인되었다(p<0.01). 하지만, 일부 사료 부착 미 생물에서의 유의적 감소에도 IVNDFD 및 VFA 발생량에 영향을 주지 않았음을 고려할 때, 사료 주머니의 사용은 반추 미생물의 기질 이용성에 큰 영향을 미치지 않는 것으 로 사료된다.

Ⅳ. 요약

생물학적 평가 방법 중 in situ 와 in vitro 평가 방법은 비용 및 시간을 절약할 수 있으며 동물 복지 측면에서 제 약이 적어 주목되고 있는 방법이다.In vitro 실험에서 사용 되는 사료 접종법으로 배양병에 직접 사료를 담는 dispersion 방법은 실제 반추위 발효 상황에 근접한 조건 에서 실험할 수 있는 장점이 있지만, 시간과 노동력이 많 이 소모된다. 반대로 사료 주머니를 이용한 방법은 실험 수행의 편이성이 있지만 첨가제 실험 수행의 제약이 있으 며, 미생물 활성과 섬유소 소화율이 저하되는 단점이 있다.

본 실험은 dispersion 방법과 사료 주머니 방법을 조합하 여 보다 편리한 방법으로 dispersion 에 가까운 높은 재현 성의 발효 성상과 소화율 평가 가능할 것이라고 생각하여 in vitro 발효 성상과 미생물 조성을 비교하였다.

Dispersion 방법과 nylon bag 을 조합한 실험에서 건물 소화율은 세척 과정에서 미생물 및 사료 입자의 유실로 과 대평가될 수 있지만 이론적 최대 가스 발생량 V

max

발생량에 대한 분해 속도 상수 K

g

3

Real-time PCR 을 이용한 미생물 조성 분석에서는 general bacteria 의 절대량에서 유의적 차이가 나지 않았다. 상기 의 결과를 종합해 볼 때, in vitro 실험에서 사료 주머니의 사용은 충분히 적용가능하며 일반적인 방법인 dispersion 과 비교해 볼 때, 영양소 이용에 있어 반추미생물의 사료 접촉을 방해하지 않을 것으로 생각된다. 하지만 in vitro bach culture 방법은 배양조건에서 제약이 있어, 향후 연속 배양 방법과 in situ 의 실험을 통해 본 실험의 실험결과에 대한 추가적인 규명이 필요할 것으로 사료된다.

사사

본 논문은 농촌진흥청 차세대 바이오그린21사업(세부과 제번호: PJ01329201)의 지원에 의해 이루어진 것임.

Ⅴ. 참고문헌

1. AOAC, 2005. Official Methods of Analysis of AOAC International. Association of Official Analytical Chemists International, Gaithersburg, MD, USA.

[Provider:earticle] Download by IP 118.70.52.165 at Monday, December 20, 2021 7:47 PM

www.earticle.net

2. Chaney, A. L. and Marbach, E. P. 1962. Modified reagents for determination of urea and ammonia.

Clinical chemistry 8:130-132.

3. Denman, S. E. and McSweeney, C. S. 2006.

Development of a real‐time PCR assay for monitoring anaerobic fungal and cellulolytic bacterial populations within the rumen. FEMS microbiol. ecol. 58:572-582.

4. Erwin, E., Marco, G. and Emery, E. 1961. Volatile fatty acid analyses of blood and rumen fluid by gas chromatography. J Dairy Sci. 44:1768-1771.

5. Ellis, W. C., Matis, J. H., Hill, T. M. and Murphy, M.

R. 1994. Methodology for estimating digestion and passage kinetics of forages. Forage quality, evaluation, and utilization, (foragequalityev), 682-756.

6. Firkins, J., Yu, Z. and Morrison, M. 2007. Ruminal nitrogen metabolism: perspectives for integration of microbiology and nutrition for dairy1, 2. J. Dairy Sci.

90:E1-E16.

7. Getachew, G., Blümmel, M., Makkar, H. P. S. and Becker, K. 1998. In vitro gas measuring techniques for assessment of nutritional quality of feeds: a review. J.

Anim. Sci. Technol. 72(3-4):261-281.

8. Goering, H. and Van Soest, P. 1979. Forage Fiber Analyses:(apparatus, Reagents, Procedures, and Some Applications). Agricultural Research Service, US Department of Agriculture.

9. Ha, J., Lee, S., Moon, Y. and Kim, C. 2005. Ruminant nutrition and physiology. Seoul National University press. Seoul, Korea.

10. Ki, K. S., Park, S. B., Lim, D. H. and Seo, S. 2017.

Evaluation of the nutritional value of locally produced forage in Korea using chemical analysis and in vitro ruminal fermentation. Asian-Australas J.

Anim. Sci. 30:355.

11. Lee, C., Kim, J., Shin, S. G. and Hwang, S. 2006.

Absolute and relative QPCR quantification of plasmid copy number inEscherichia coli. J. Biotechnol.

123:273-280.

12. Lindberg, J. E. and Knutsson, P. G. 1981. Effect of bag pore size on the loss of particulate matter and on the degradation of cell wall fibre. Agriculture and Environmental Sciences (JAES), 6(2-3):171-182.

13. NRC. Nutrient requirements of dairy cattle. 2001.

National Academic Press. Washington, D.C. USA.

14. Raffrenato, E., Ross, D. A. and Van Amburgh, M. E.

2018. Development of an in vitro method to determine rumen undigested aNDFom for use in feed evaluation. J. Dairy Sci. 101(11):9888-9900.

15. Russell, J. B. and Hespell, R. B. 1981. Microbial rumen fermentation. J. Dairy Sci. 64(6):1153-1169.

16. Russell, J. B. and Wilson, D. B. 1996. Why are ruminal cellulolytic bacteria unable to digest cellulose at low pH? J. Dairy Sci. 79:1503-1509.

17. Schofield, P., Pitt, R. and Pell, A. 1994. Kinetics of fiber digestion from in vitro gas production. J. Anim.

Sci. 72:2980-2991.

18. Sommart, K., Parker, D. S., Rowlinson, P. and Wanapat, M. 2000. Fermentation characteristics and microbial protein synthesis in an in vitro system using cassava, rice straw and dried ruzi grass as substrates. Asian-Australas J. Anim. Sci.

13(8):1084-1093.

19. Sylvester, J. T., Karnati, S. K., Yu, Z., Morrison, M.

and Firkins, J. L. 2004. Development of an assay to quantify rumen ciliate protozoal biomass in cows using real-time PCR. Nutr. J. 134:3378-3384.

20. Tagliapietra, F., Cattani, M., Hindrichsen, I. K., Hansen, H. H., Colombini, S., Bailoni, L. and Schiavon, S. 2012. True dry matter digestibility of feeds evaluated in situ with different bags and in vitro using rumen fluid collected from intact donor cows. Anim. Prod. Sci. 52:338-346.

21. Theodorou, M. K., Williams, B. A., Dhanoa, M. S., McAllan, A. B. and France, J. 1994. A simple gas production method using a pressure transducer to determine the fermentation kinetics of ruminant feeds. J. Anim. Sci. Technol. 48:185-197.

22. Tilley, J. and Terry, R. 1963. A two‐stage technique for the in vitro digestion of forage crops. Grass Forage Sci. 18:104-111.S

23. Valente, T. N. P., Detmann, E. and Sampaio, C. B.

2015. Recent advances in evaluation of bags made from different textiles used in situ ruminal degradation. Can. J. Anim. Sci. 95:493-498.

[Provider:earticle] Download by IP 118.70.52.165 at Monday, December 20, 2021 7:47 PM

www.earticle.net

24. Van Soest, Pv., Robertson, J. and Lewis, B. 1991.

Methods for dietary fiber, neutral detergent fiber, and nonstarch polysaccharides in relation to animal nutrition. J. Dairy Sci. 74:3583-3597.

25. Vogel, K. P., Pedersen, J. F., Masterson, S. D. and Toy, J. J. 1999. Evaluation of a filter bag system for NDF, ADF, and IVDMD forage analysis. J. Crop. Sci.

39(1):276-279.

26. Wilman, D. and Adesogan, A. 2000. A comparison of

filter bag methods with conventional tube methods of determining the in vitro digestibility of forages. J.

Anim. Sci. Technol. 84:33-47.

27. Wang, R. F., Cao, W. W. and Cerniglia, C. E. 1997.

PCR detection of Ruminococcus spp. in human and animal faecal samples. Mol. Cell Probes. 11:259-265.

(Received 16 August 2019, Revised 26 September 2019, Accepted 26 September 2019)

[Provider:earticle] Download by IP 118.70.52.165 at Monday, December 20, 2021 7:47 PM