• 검색 결과가 없습니다.

Development of a Genetic Map of Chili Pepper Using Single Nucleotide Polymorphism Markers Generated from Next Generation Resequencing of Parents

N/A
N/A
Protected

Academic year: 2021

Share "Development of a Genetic Map of Chili Pepper Using Single Nucleotide Polymorphism Markers Generated from Next Generation Resequencing of Parents"

Copied!
10
0
0

로드 중.... (전체 텍스트 보기)

전체 글

Loading

수치

Table 1. Next generation resequencing of parents, ‘NB1’ and ‘Jolokia’.
Table 2. List of 116 SNP markers used for pepper genetic mapping in this study. SNP (HRM) markerzPrevious markeryLGxPositionwGene descriptionvForward primer (5’→3’)Reverse primer (5’→3’) 276428C2At1g6398010.0Pin2-interacting protein X1TGAAACAATTATTGGACAACA
Table 2. Continued. SNP (HRM) markerzPrevious markeryLGxPositionwGene descriptionvForward primer (5’→3’)Reverse primer (5’→3’) 50987C2At5g62390372.5IQ calmodulin-binding motif family proteinTTTTCAAAACCCTAACATAAACTTCAATACAGTCGCTACGAAATATGCAA 1339999C2At5g23
Table 2. Continued. SNP (HRM) markerzPrevious markeryLGxPositionwGene descriptionvForward primer (5’→3’)Reverse primer (5’→3’) 38802C2At4g0234060.0Epoxide hydrolase 1GAACTACAGAATCGGACTTGTTGAAATCATCCGATTCAGATTTTTCAT 564798C2At1g4954066.5Elongator complex pr
+3

참조

관련 문서

The proposal of the cell theory as the birth of contemporary cell biology Microscopic studies of plant tissues by Schleiden and of animal tissues by Microscopic studies of

[r]

http://blog.naver.com/op2330

산출 자료에

It considers the energy use of the different components that are involved in the distribution and viewing of video content: data centres and content delivery networks

After first field tests, we expect electric passenger drones or eVTOL aircraft (short for electric vertical take-off and landing) to start providing commercial mobility

동결방지 조치를 취하여 등을 사용하여 적절한 우려가 있는 곳은 보온재 드레인 호스 설치시 동결.

[r]