• 검색 결과가 없습니다.

Temporal gene expression pattern in podocyte exposed to high glucose

N/A
N/A
Protected

Academic year: 2021

Share "Temporal gene expression pattern in podocyte exposed to high glucose"

Copied!
68
0
0

로드 중.... (전체 텍스트 보기)

전체 글

Loading

수치

Table 1. Sequences of primers used for real-time PCR and expected gene  fragment sizes     Sequence (5' →3') bp  TSP-1  Sense  GGTGAGAGCTGATTGACCCAAT  Antisense  GGCCACTGCAGGTGAGAAGT  113
Table  2.  Genes  up-  or  down-regulated  at  2,  6,  24,  and  48  hr  under  high  glucose condition
Figure  1.  Cluster  analysis  of  differentially  expressed  genes  identified  by  microarray analysis of LG- and HG-treated podocytes
Table 3. The list of genes showing pattern of clusters A-C
+7

참조

관련 문서

1. Prismless layer was commonly observed on the fissure enamel in young and mature premolar. There were no differences in micro-structure and etching

Therefore, in this study, based on the media facade expression characteristics and expression techniques, evaluation factors through satisfaction analysis on

In this way, it is possible to shorten the time of accident restoration and maintenance by minimizing the expression error of the high-strength facial

We found that FoxO1 is constantly increased in MCF-7/ADR, adriamycin-resistant breast cancer cells, and FoxO1 has a critical role in the MDR1 gene expression (16).. There is

This study was conducted under the hypothesis that a group art therapy program may increase emotional expression and decrease life event stress in patients with

Actinic keratoses showed a trend towards increased expression in the basal layer compared with normal skin.. In actinic keratoses, Keratoacanthomas and seborrheic

Results : The expression of p21 was increased in boderline serous tumor and serous cystadenocarcinoma in contrast to benign serous tumors. The expression of

Effect of caloric restriction on the expression of PGC-1 and PPARs mRNA in liver of Otsuka Long-Evans Tokushima Fatty Rats.. Long-lived growth hormone