• 검색 결과가 없습니다.

Protective effects of 5-aminolevulinic acid on heat stress in bovine mammary epithelial cells

N/A
N/A
Protected

Academic year: 2021

Share "Protective effects of 5-aminolevulinic acid on heat stress in bovine mammary epithelial cells"

Copied!
8
0
0

로드 중.... (전체 텍스트 보기)

전체 글

Loading

수치

Table 1.  Sequences of primers used for real-time polymerase chain  reaction amplification Gene Primers (5’ to 3’) XBP1s Forward  TGCTGAGTCCGCAGCAGGTG Reverse  GCTGGCAGACTCTGGGGAAG  GRP78 Forward GATTGAAGTCACCTTTGAGATAGATGTG  Reverse  GATCTTATTTTTGTTGCCTGT
Figure 2.  5-ALA counters HS reduced cell viability in bovine MECs. (A) Bovine MECs were pretreated with or without 5-ALA at concentrations of  10, 100, and 500 μM for 24 h followed by HS (42.5°C for 48 h)
Figure 3.  Effect of 5-ALA on the expression of oxidative stress-related genes during HS
Figure 4.  5-ALA reduces HS induced ER stress. Bovine MECs were pretreated with or without 5-ALA at concentrations of 10, 100, and 500 μM for  24 h followed by HS (42.5°C for 24 h)

참조

관련 문서

/ 내 부 바닥 한가운데에 경사지게 배수로를 파서 얼음 에서 녹은 물이 밖으로 흘러 나가도록 했다... / 토의 과정에

3) Galaxy Zoo: Mergers 4) Protein Modeling 5) Online Data Challenges 1) Milky Way Project 2) modeling Lens Candidates.. 3) Galaxy Zoo: Mergers 4) Protein Modeling 5)

/ 군사력이 약화되었고 전쟁에 대한 대비가 부족했다... / 문서에 조약의

따라서 버림, 반올림하여 백의 자리까지 나타낸 수가 같은 것은 ㉢입니다... 또한, 각각의 대응점에서 대칭의

사슴의 수는 조금씩 줄어들고 비버의 수는 늘어날 것이라고 쓰거나 오랜 시간에 걸쳐 생태계는 평형을 되찾아 늑대와 사 슴의 수는 적절하게 유지되고 강가의 풀과 나무도 잘

[r]

co-treatment with hispidulin and TGF-β up-regulated the protein of expression E-cadherin and occludin against TGF-β-induced in MCF-7 and HCC38 cells.. The

자신의 꿈을 이루기 위해 노력하는 모습이 정말 멋져 보였어.. 내가 너처럼 그림 그리기 를 좋아하면 나도